Incidental Mutation 'R5196:Hdlbp'
ID400201
Institutional Source Beutler Lab
Gene Symbol Hdlbp
Ensembl Gene ENSMUSG00000034088
Gene Namehigh density lipoprotein (HDL) binding protein
Synonyms1110005P14Rik, D1Ertd101e
MMRRC Submission 042772-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.894) question?
Stock #R5196 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location93405940-93478815 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93420193 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 613 (E613G)
Ref Sequence ENSEMBL: ENSMUSP00000139671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042498] [ENSMUST00000170883] [ENSMUST00000186164]
Predicted Effect probably damaging
Transcript: ENSMUST00000042498
AA Change: E682G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000043047
Gene: ENSMUSG00000034088
AA Change: E682G

DomainStartEndE-ValueType
KH 149 217 1.97e-15 SMART
KH 221 289 1.8e-9 SMART
KH 294 362 1.73e-11 SMART
KH 363 429 2.66e-12 SMART
KH 434 502 9.18e-16 SMART
KH 506 575 7.52e-12 SMART
KH 580 648 7.68e-18 SMART
KH 652 721 3.24e-16 SMART
KH 726 795 1.33e-12 SMART
KH 799 868 2.48e-12 SMART
KH 872 972 3.03e-16 SMART
KH 973 1039 4.56e-11 SMART
KH 1051 1122 3.67e-15 SMART
KH 1126 1195 3.37e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000096427
SMART Domains Protein: ENSMUSP00000126949
Gene: ENSMUSG00000090489

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
Pfam:Ribosomal_L7Ae 124 218 8.2e-25 PFAM
low complexity region 253 264 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170883
AA Change: E682G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127903
Gene: ENSMUSG00000034088
AA Change: E682G

DomainStartEndE-ValueType
KH 149 217 1.97e-15 SMART
KH 221 289 1.8e-9 SMART
KH 294 362 1.73e-11 SMART
KH 363 429 2.66e-12 SMART
KH 434 502 9.18e-16 SMART
KH 506 575 7.52e-12 SMART
KH 580 648 7.68e-18 SMART
KH 652 721 3.24e-16 SMART
KH 726 795 1.33e-12 SMART
KH 799 868 2.48e-12 SMART
KH 872 972 3.03e-16 SMART
KH 973 1039 4.56e-11 SMART
KH 1051 1122 3.67e-15 SMART
KH 1126 1195 3.37e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186164
AA Change: E613G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139671
Gene: ENSMUSG00000034088
AA Change: E613G

DomainStartEndE-ValueType
KH 149 217 1.2e-17 SMART
KH 221 289 1.1e-11 SMART
KH 294 360 1.6e-14 SMART
KH 365 433 5.7e-18 SMART
KH 437 506 4.6e-14 SMART
KH 511 579 4.7e-20 SMART
KH 583 652 2e-18 SMART
KH 657 726 7.9e-15 SMART
KH 730 799 1.5e-14 SMART
KH 803 903 1.8e-18 SMART
KH 904 970 2.8e-13 SMART
KH 982 1053 2.2e-17 SMART
KH 1057 1126 2e-16 SMART
Meta Mutation Damage Score 0.6709 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds high density lipoprotein (HDL) and may function to regulate excess cholesterol levels in cells. The encoded protein also binds RNA and can induce heterochromatin formation. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,796,438 T281A possibly damaging Het
4930503B20Rik A G 3: 146,646,263 probably benign Het
6330409D20Rik T A 2: 32,740,540 probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Amigo2 A G 15: 97,246,061 F160S probably damaging Het
Arcn1 A T 9: 44,760,027 L68M probably damaging Het
Arhgef25 A G 10: 127,185,109 S303P probably damaging Het
Asph A T 4: 9,607,830 S163T probably damaging Het
BC003331 T A 1: 150,382,389 D165V probably damaging Het
Birc6 T C 17: 74,606,141 probably benign Het
Ccm2 G A 11: 6,561,181 probably benign Het
Cdc42bpa T C 1: 180,072,413 V431A probably benign Het
Cdh7 T A 1: 110,138,000 M668K probably damaging Het
Cfap43 A T 19: 47,825,925 W157R probably damaging Het
Chrm5 T C 2: 112,480,384 Y129C probably damaging Het
Chrna5 A G 9: 55,006,519 I421V possibly damaging Het
Clk1 T A 1: 58,414,613 T301S probably benign Het
Col6a3 G T 1: 90,816,538 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam198a T G 9: 121,965,661 S294A probably benign Het
Fbxw19 T C 9: 109,484,428 Y234C probably benign Het
Fgd4 T A 16: 16,484,142 N183I probably benign Het
Fnip2 T C 3: 79,572,538 probably benign Het
Gm9847 T A 12: 14,495,015 noncoding transcript Het
H2-T23 A G 17: 36,032,607 probably null Het
Kat6a G A 8: 22,911,713 R366H probably damaging Het
Kctd4 A G 14: 75,962,687 T33A probably benign Het
Klrb1c T A 6: 128,780,299 S268C probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrfip1 A G 1: 91,114,608 E245G probably damaging Het
Mast3 A T 8: 70,788,245 I220N probably damaging Het
Mfap3 A G 11: 57,529,813 T207A probably damaging Het
Mtdh G T 15: 34,118,004 K75N probably damaging Het
Mybpc1 A G 10: 88,536,351 Y806H probably damaging Het
Ntng1 T C 3: 109,934,983 D158G probably damaging Het
Olfr1176 A G 2: 88,339,748 Y61C possibly damaging Het
Olfr812 T A 10: 129,842,781 D87V possibly damaging Het
Pask A G 1: 93,310,083 probably benign Het
Pif1 G T 9: 65,588,092 A95S probably benign Het
Plppr2 T C 9: 21,941,132 F104S probably damaging Het
Prmt9 G A 8: 77,564,997 V333M probably benign Het
Pten A T 19: 32,815,497 M239L probably benign Het
Rb1cc1 A G 1: 6,234,230 D67G probably damaging Het
Reg2 T A 6: 78,405,547 L12* probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc5a7 C A 17: 54,281,722 probably null Het
Tcaf3 G T 6: 42,593,715 R368S probably benign Het
Tfcp2 A G 15: 100,520,714 V189A probably damaging Het
Uhrf1bp1 A G 17: 27,856,763 I5V probably benign Het
Wdr12 T C 1: 60,087,084 S191G probably damaging Het
Zfp536 G A 7: 37,480,760 R807W probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Hdlbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Hdlbp APN 1 93430169 missense probably benign 0.00
IGL01321:Hdlbp APN 1 93423802 missense probably damaging 1.00
IGL01387:Hdlbp APN 1 93413588 missense possibly damaging 0.91
IGL01443:Hdlbp APN 1 93431074 missense probably damaging 0.99
IGL01467:Hdlbp APN 1 93417698 splice site probably benign
IGL02223:Hdlbp APN 1 93412449 missense probably damaging 1.00
IGL02274:Hdlbp APN 1 93408507 splice site probably null
IGL02452:Hdlbp APN 1 93417511 missense probably damaging 1.00
IGL03079:Hdlbp APN 1 93413940 splice site probably benign
IGL03169:Hdlbp APN 1 93416587 missense possibly damaging 0.92
IGL03229:Hdlbp APN 1 93430187 missense probably benign 0.00
R0119:Hdlbp UTSW 1 93421337 splice site probably benign
R0432:Hdlbp UTSW 1 93425332 missense probably damaging 1.00
R0508:Hdlbp UTSW 1 93414811 critical splice donor site probably null
R0530:Hdlbp UTSW 1 93430317 unclassified probably benign
R1276:Hdlbp UTSW 1 93421101 missense probably benign 0.12
R1302:Hdlbp UTSW 1 93423385 splice site probably null
R1331:Hdlbp UTSW 1 93421131 missense probably damaging 1.00
R1537:Hdlbp UTSW 1 93417374 missense probably benign 0.01
R1623:Hdlbp UTSW 1 93423869 missense probably damaging 1.00
R1695:Hdlbp UTSW 1 93437200 missense probably damaging 1.00
R1897:Hdlbp UTSW 1 93422285 intron probably benign
R1900:Hdlbp UTSW 1 93422237 intron probably benign
R1984:Hdlbp UTSW 1 93431118 missense probably damaging 0.98
R1985:Hdlbp UTSW 1 93431118 missense probably damaging 0.98
R2066:Hdlbp UTSW 1 93421880 intron probably benign
R2277:Hdlbp UTSW 1 93408178 nonsense probably null
R2349:Hdlbp UTSW 1 93422234 intron probably benign
R3434:Hdlbp UTSW 1 93428161 missense probably benign 0.04
R3978:Hdlbp UTSW 1 93421351 missense probably damaging 1.00
R4645:Hdlbp UTSW 1 93422120 intron probably benign
R5760:Hdlbp UTSW 1 93440777 intron probably benign
R6327:Hdlbp UTSW 1 93429464 missense possibly damaging 0.87
R6420:Hdlbp UTSW 1 93431004 missense probably damaging 1.00
R6428:Hdlbp UTSW 1 93431445 missense possibly damaging 0.91
R6468:Hdlbp UTSW 1 93417667 missense possibly damaging 0.48
R6488:Hdlbp UTSW 1 93428224 missense probably damaging 1.00
R6592:Hdlbp UTSW 1 93412361 critical splice donor site probably null
R6920:Hdlbp UTSW 1 93412361 critical splice donor site probably null
R7156:Hdlbp UTSW 1 93413915 missense probably damaging 1.00
R7391:Hdlbp UTSW 1 93431061 missense possibly damaging 0.93
R7457:Hdlbp UTSW 1 93428222 missense probably benign 0.04
R7498:Hdlbp UTSW 1 93413615 missense probably benign 0.00
R7554:Hdlbp UTSW 1 93437309 missense probably damaging 0.96
R7593:Hdlbp UTSW 1 93430283 missense probably benign 0.01
R7672:Hdlbp UTSW 1 93437099 missense possibly damaging 0.90
R7801:Hdlbp UTSW 1 93430307 splice site probably null
R7904:Hdlbp UTSW 1 93423370 missense probably damaging 1.00
R7987:Hdlbp UTSW 1 93423370 missense probably damaging 1.00
R8062:Hdlbp UTSW 1 93438342 missense probably benign 0.10
RF020:Hdlbp UTSW 1 93440734 missense probably benign
Z1088:Hdlbp UTSW 1 93431354 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGAGCACTGAAGGGTTTTCC -3'
(R):5'- GCACATCTTAGAGTGTCTCCCC -3'

Sequencing Primer
(F):5'- GGTTTTCCCTACCAAGAAAGAGAGC -3'
(R):5'- AGTGTCTCCCCCACTCCTATTTC -3'
Posted On2016-07-06