Incidental Mutation 'R5196:BC003331'
ID400208
Institutional Source Beutler Lab
Gene Symbol BC003331
Ensembl Gene ENSMUSG00000006010
Gene NamecDNA sequence BC003331
Synonyms
MMRRC Submission 042772-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.643) question?
Stock #R5196 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location150361305-150393080 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 150382389 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 165 (D165V)
Ref Sequence ENSEMBL: ENSMUSP00000107544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006167] [ENSMUST00000094477] [ENSMUST00000097546] [ENSMUST00000097547] [ENSMUST00000111913]
Predicted Effect probably damaging
Transcript: ENSMUST00000006167
AA Change: D165V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006167
Gene: ENSMUSG00000006010
AA Change: D165V

DomainStartEndE-ValueType
Pfam:ODR4-like 28 364 1.8e-107 PFAM
transmembrane domain 402 424 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094477
AA Change: D165V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092050
Gene: ENSMUSG00000006010
AA Change: D165V

DomainStartEndE-ValueType
Pfam:ODR4-like 28 383 2.8e-120 PFAM
transmembrane domain 424 446 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097546
AA Change: D165V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095152
Gene: ENSMUSG00000006010
AA Change: D165V

DomainStartEndE-ValueType
Pfam:ODR4-like 28 364 1.8e-107 PFAM
transmembrane domain 402 424 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097547
AA Change: D165V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095153
Gene: ENSMUSG00000006010
AA Change: D165V

DomainStartEndE-ValueType
Pfam:ODR4-like 28 209 1.2e-57 PFAM
Pfam:ODR4-like 206 354 3.1e-43 PFAM
transmembrane domain 392 414 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111913
AA Change: D165V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107544
Gene: ENSMUSG00000006010
AA Change: D165V

DomainStartEndE-ValueType
Pfam:ODR4-like 28 386 7.1e-113 PFAM
transmembrane domain 424 446 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150615
Meta Mutation Damage Score 0.2609 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,796,438 T281A possibly damaging Het
4930503B20Rik A G 3: 146,646,263 probably benign Het
6330409D20Rik T A 2: 32,740,540 probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Amigo2 A G 15: 97,246,061 F160S probably damaging Het
Arcn1 A T 9: 44,760,027 L68M probably damaging Het
Arhgef25 A G 10: 127,185,109 S303P probably damaging Het
Asph A T 4: 9,607,830 S163T probably damaging Het
Birc6 T C 17: 74,606,141 probably benign Het
Ccm2 G A 11: 6,561,181 probably benign Het
Cdc42bpa T C 1: 180,072,413 V431A probably benign Het
Cdh7 T A 1: 110,138,000 M668K probably damaging Het
Cfap43 A T 19: 47,825,925 W157R probably damaging Het
Chrm5 T C 2: 112,480,384 Y129C probably damaging Het
Chrna5 A G 9: 55,006,519 I421V possibly damaging Het
Clk1 T A 1: 58,414,613 T301S probably benign Het
Col6a3 G T 1: 90,816,538 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam198a T G 9: 121,965,661 S294A probably benign Het
Fbxw19 T C 9: 109,484,428 Y234C probably benign Het
Fgd4 T A 16: 16,484,142 N183I probably benign Het
Fnip2 T C 3: 79,572,538 probably benign Het
Gm9847 T A 12: 14,495,015 noncoding transcript Het
H2-T23 A G 17: 36,032,607 probably null Het
Hdlbp T C 1: 93,420,193 E613G probably damaging Het
Kat6a G A 8: 22,911,713 R366H probably damaging Het
Kctd4 A G 14: 75,962,687 T33A probably benign Het
Klrb1c T A 6: 128,780,299 S268C probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrfip1 A G 1: 91,114,608 E245G probably damaging Het
Mast3 A T 8: 70,788,245 I220N probably damaging Het
Mfap3 A G 11: 57,529,813 T207A probably damaging Het
Mtdh G T 15: 34,118,004 K75N probably damaging Het
Mybpc1 A G 10: 88,536,351 Y806H probably damaging Het
Ntng1 T C 3: 109,934,983 D158G probably damaging Het
Olfr1176 A G 2: 88,339,748 Y61C possibly damaging Het
Olfr812 T A 10: 129,842,781 D87V possibly damaging Het
Pask A G 1: 93,310,083 probably benign Het
Pif1 G T 9: 65,588,092 A95S probably benign Het
Plppr2 T C 9: 21,941,132 F104S probably damaging Het
Prmt9 G A 8: 77,564,997 V333M probably benign Het
Pten A T 19: 32,815,497 M239L probably benign Het
Rb1cc1 A G 1: 6,234,230 D67G probably damaging Het
Reg2 T A 6: 78,405,547 L12* probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc5a7 C A 17: 54,281,722 probably null Het
Tcaf3 G T 6: 42,593,715 R368S probably benign Het
Tfcp2 A G 15: 100,520,714 V189A probably damaging Het
Uhrf1bp1 A G 17: 27,856,763 I5V probably benign Het
Wdr12 T C 1: 60,087,084 S191G probably damaging Het
Zfp536 G A 7: 37,480,760 R807W probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in BC003331
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01876:BC003331 APN 1 150382338 missense probably benign 0.10
IGL02189:BC003331 APN 1 150372033 missense possibly damaging 0.94
IGL02257:BC003331 APN 1 150386404 missense probably damaging 0.99
IGL02485:BC003331 APN 1 150363489 critical splice donor site probably null
IGL02585:BC003331 APN 1 150363521 missense probably damaging 0.96
IGL02712:BC003331 APN 1 150386356 critical splice donor site probably null
IGL02902:BC003331 APN 1 150384428 critical splice donor site probably null
IGL03014:BC003331 APN 1 150383053 splice site probably benign
IGL03124:BC003331 APN 1 150386425 missense probably benign 0.00
IGL03181:BC003331 APN 1 150363539 missense probably benign 0.06
IGL03344:BC003331 APN 1 150363544 missense probably damaging 0.99
R1170:BC003331 UTSW 1 150386391 missense probably benign 0.00
R1796:BC003331 UTSW 1 150375554 missense probably benign
R1902:BC003331 UTSW 1 150388609 unclassified probably null
R2149:BC003331 UTSW 1 150388559 missense probably benign 0.05
R2155:BC003331 UTSW 1 150382335 missense possibly damaging 0.68
R2375:BC003331 UTSW 1 150390234 critical splice donor site probably null
R3786:BC003331 UTSW 1 150384531 missense probably benign 0.21
R3948:BC003331 UTSW 1 150388557 nonsense probably null
R4589:BC003331 UTSW 1 150384487 missense probably benign 0.11
R4590:BC003331 UTSW 1 150386352 splice site probably null
R4815:BC003331 UTSW 1 150374846 missense probably damaging 0.99
R5437:BC003331 UTSW 1 150363518 missense probably benign 0.01
R5549:BC003331 UTSW 1 150372158 missense possibly damaging 0.86
R5677:BC003331 UTSW 1 150374837 missense probably damaging 1.00
R5896:BC003331 UTSW 1 150380360 missense probably benign 0.10
R6472:BC003331 UTSW 1 150381522 missense probably benign 0.15
R7108:BC003331 UTSW 1 150382290 missense probably benign 0.01
R7402:BC003331 UTSW 1 150386356 critical splice donor site probably null
R7662:BC003331 UTSW 1 150382294 missense probably benign
R7767:BC003331 UTSW 1 150372037 missense probably benign 0.00
R7810:BC003331 UTSW 1 150392908 utr 5 prime probably benign
R8114:BC003331 UTSW 1 150388557 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATATTAACAGCAGAGGGCCCAC -3'
(R):5'- CTGTCGAGCTTGTATGAAAGTAAG -3'

Sequencing Primer
(F):5'- GCCCACTCAGCCATCACTG -3'
(R):5'- CCCTGAAGTCAGGGAATTT -3'
Posted On2016-07-06