Mutagenetix > Incidental Mutation

Incidental Mutation 'R5196:Cdc42bpa'

400210

Institutional Source

Beutler Lab

Gene Symbol

Cdc42bpa

Ensembl Gene

ENSMUSG00000026490

Gene Name

CDC42 binding protein kinase alpha

Synonyms

A930014J19Rik, DMPK-like

MMRRC Submission

042772-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.816) question?

Stock #

R5196 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

179960472-180165603 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 180072413 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 431 (V431A)

Ref Sequence

ENSEMBL: ENSMUSP00000095059 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076687] [ENSMUST00000097450] [ENSMUST00000097453] [ENSMUST00000111117] [ENSMUST00000134959] [ENSMUST00000212756]

AlphaFold

Q3UU96

Predicted Effect

probably benign
Transcript: ENSMUST00000076687
AA Change: V431A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000075980
Gene: ENSMUSG00000026490
AA Change: V431A

Domain	Start	End	E-Value	Type
S_TKc	77	343	1.06e-86	SMART
S_TK_X	344	406	1.18e-15	SMART
coiled coil region	435	588	N/A	INTRINSIC
coiled coil region	632	735	N/A	INTRINSIC
Pfam:DMPK_coil	800	860	2.7e-29	PFAM
C1	919	968	4.09e-7	SMART
PH	989	1109	6.02e-8	SMART
CNH	1134	1411	3.37e-17	SMART
low complexity region	1456	1468	N/A	INTRINSIC
PBD	1477	1512	2.05e-10	SMART
low complexity region	1531	1546	N/A	INTRINSIC
low complexity region	1567	1580	N/A	INTRINSIC
low complexity region	1606	1620	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000097450
AA Change: V431A

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000095059
Gene: ENSMUSG00000026490
AA Change: V431A

Domain	Start	End	E-Value	Type
S_TKc	77	343	1.06e-86	SMART
S_TK_X	344	406	1.18e-15	SMART
coiled coil region	435	669	N/A	INTRINSIC
coiled coil region	713	816	N/A	INTRINSIC
Pfam:DMPK_coil	881	941	2.2e-29	PFAM
C1	1000	1049	4.09e-7	SMART
PH	1070	1190	6.02e-8	SMART
CNH	1215	1492	3.37e-17	SMART
low complexity region	1537	1549	N/A	INTRINSIC
PBD	1558	1593	2.05e-10	SMART
low complexity region	1612	1627	N/A	INTRINSIC
low complexity region	1648	1661	N/A	INTRINSIC
low complexity region	1687	1701	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000097453
AA Change: V431A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000095062
Gene: ENSMUSG00000026490
AA Change: V431A

Domain	Start	End	E-Value	Type
S_TKc	77	343	1.06e-86	SMART
S_TK_X	344	406	1.18e-15	SMART
coiled coil region	435	669	N/A	INTRINSIC
coiled coil region	713	816	N/A	INTRINSIC
Pfam:DMPK_coil	881	941	2.5e-29	PFAM
C1	972	1021	4.09e-7	SMART
PH	1042	1162	6.02e-8	SMART
CNH	1187	1464	3.37e-17	SMART
low complexity region	1509	1521	N/A	INTRINSIC
PBD	1530	1565	2.05e-10	SMART
low complexity region	1584	1599	N/A	INTRINSIC
low complexity region	1620	1633	N/A	INTRINSIC
low complexity region	1659	1673	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111117
AA Change: V431A

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000106746
Gene: ENSMUSG00000026490
AA Change: V431A

Domain	Start	End	E-Value	Type
S_TKc	77	343	1.06e-86	SMART
S_TK_X	344	406	1.18e-15	SMART
low complexity region	484	499	N/A	INTRINSIC
Pfam:KELK	529	608	1.1e-32	PFAM
coiled coil region	713	816	N/A	INTRINSIC
Pfam:DMPK_coil	881	941	2.6e-29	PFAM
C1	1013	1062	4.09e-7	SMART
PH	1083	1203	6.02e-8	SMART
CNH	1228	1505	3.37e-17	SMART
low complexity region	1550	1562	N/A	INTRINSIC
PBD	1571	1606	2.05e-10	SMART
low complexity region	1625	1640	N/A	INTRINSIC
low complexity region	1661	1674	N/A	INTRINSIC
low complexity region	1700	1714	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000134959

SMART Domains

Protein: ENSMUSP00000142018
Gene: ENSMUSG00000026490

Domain	Start	End	E-Value	Type
PDB:4AW2\|A	2	90	1e-58	PDB
SCOP:d1koba_	50	90	7e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000212756
AA Change: V431A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

Meta Mutation Damage Score

0.0769

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Serine/Threonine protein kinase family. This kinase contains multiple functional domains. Its kinase domain is highly similar to that of the myotonic dystrophy protein kinase (DMPK). This kinase also contains a Rac interactive binding (CRIB) domain, and has been shown to bind CDC42. It may function as a CDC42 downstream effector mediating CDC42 induced peripheral actin formation, and promoting cytoskeletal reorganization. Multiple alternatively spliced transcript variants have been described, and the full-length nature of two of them has been reported. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001O22Rik	T	C	2: 30,796,438	T281A	possibly damaging	Het
4930503B20Rik	A	G	3: 146,646,263		probably benign	Het
6330409D20Rik	T	A	2: 32,740,540		probably benign	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Amigo2	A	G	15: 97,246,061	F160S	probably damaging	Het
Arcn1	A	T	9: 44,760,027	L68M	probably damaging	Het
Arhgef25	A	G	10: 127,185,109	S303P	probably damaging	Het
Asph	A	T	4: 9,607,830	S163T	probably damaging	Het
BC003331	T	A	1: 150,382,389	D165V	probably damaging	Het
Birc6	T	C	17: 74,606,141		probably benign	Het
Ccm2	G	A	11: 6,561,181		probably benign	Het
Cdh7	T	A	1: 110,138,000	M668K	probably damaging	Het
Cfap43	A	T	19: 47,825,925	W157R	probably damaging	Het
Chrm5	T	C	2: 112,480,384	Y129C	probably damaging	Het
Chrna5	A	G	9: 55,006,519	I421V	possibly damaging	Het
Clk1	T	A	1: 58,414,613	T301S	probably benign	Het
Col6a3	G	T	1: 90,816,538		probably null	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fam198a	T	G	9: 121,965,661	S294A	probably benign	Het
Fbxw19	T	C	9: 109,484,428	Y234C	probably benign	Het
Fgd4	T	A	16: 16,484,142	N183I	probably benign	Het
Fnip2	T	C	3: 79,572,538		probably benign	Het
Gm9847	T	A	12: 14,495,015		noncoding transcript	Het
H2-T23	A	G	17: 36,032,607		probably null	Het
Hdlbp	T	C	1: 93,420,193	E613G	probably damaging	Het
Kat6a	G	A	8: 22,911,713	R366H	probably damaging	Het
Kctd4	A	G	14: 75,962,687	T33A	probably benign	Het
Klrb1c	T	A	6: 128,780,299	S268C	probably benign	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lrrfip1	A	G	1: 91,114,608	E245G	probably damaging	Het
Mast3	A	T	8: 70,788,245	I220N	probably damaging	Het
Mfap3	A	G	11: 57,529,813	T207A	probably damaging	Het
Mtdh	G	T	15: 34,118,004	K75N	probably damaging	Het
Mybpc1	A	G	10: 88,536,351	Y806H	probably damaging	Het
Ntng1	T	C	3: 109,934,983	D158G	probably damaging	Het
Olfr1176	A	G	2: 88,339,748	Y61C	possibly damaging	Het
Olfr812	T	A	10: 129,842,781	D87V	possibly damaging	Het
Pask	A	G	1: 93,310,083		probably benign	Het
Pif1	G	T	9: 65,588,092	A95S	probably benign	Het
Plppr2	T	C	9: 21,941,132	F104S	probably damaging	Het
Prmt9	G	A	8: 77,564,997	V333M	probably benign	Het
Pten	A	T	19: 32,815,497	M239L	probably benign	Het
Rb1cc1	A	G	1: 6,234,230	D67G	probably damaging	Het
Reg2	T	A	6: 78,405,547	L12*	probably null	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Slc5a7	C	A	17: 54,281,722		probably null	Het
Tcaf3	G	T	6: 42,593,715	R368S	probably benign	Het
Tfcp2	A	G	15: 100,520,714	V189A	probably damaging	Het
Uhrf1bp1	A	G	17: 27,856,763	I5V	probably benign	Het
Wdr12	T	C	1: 60,087,084	S191G	probably damaging	Het
Zfp536	G	A	7: 37,480,760	R807W	probably damaging	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het

Other mutations in Cdc42bpa

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Cdc42bpa	APN	1	180106121	missense	probably damaging	1.00
IGL00807:Cdc42bpa	APN	1	180141453	missense	possibly damaging	0.88
IGL00972:Cdc42bpa	APN	1	180074684	missense	probably benign	0.00
IGL01084:Cdc42bpa	APN	1	180142274	splice site	probably benign
IGL01149:Cdc42bpa	APN	1	180074572	missense	probably damaging	0.99
IGL01377:Cdc42bpa	APN	1	180065143	missense	probably damaging	1.00
IGL01541:Cdc42bpa	APN	1	180151158	critical splice acceptor site	probably null
IGL01657:Cdc42bpa	APN	1	180111866	missense	probably benign	0.05
IGL01720:Cdc42bpa	APN	1	180111282	missense	probably damaging	1.00
IGL02227:Cdc42bpa	APN	1	180094424	missense	possibly damaging	0.64
IGL02234:Cdc42bpa	APN	1	180151191	nonsense	probably null
IGL02253:Cdc42bpa	APN	1	180031596	splice site	probably benign
IGL02587:Cdc42bpa	APN	1	180093945	missense	possibly damaging	0.91
IGL02671:Cdc42bpa	APN	1	180061822	missense	probably benign
IGL02746:Cdc42bpa	APN	1	180111747	missense	possibly damaging	0.91
IGL02756:Cdc42bpa	APN	1	180109259	missense	possibly damaging	0.77
IGL02994:Cdc42bpa	APN	1	179999437	missense	probably damaging	1.00
IGL03073:Cdc42bpa	APN	1	180094376	splice site	probably benign
IGL03295:Cdc42bpa	APN	1	180150204	missense	probably benign	0.00
P0022:Cdc42bpa	UTSW	1	179961276	missense	probably damaging	0.99
PIT4142001:Cdc42bpa	UTSW	1	180031560	missense	probably damaging	1.00
R0125:Cdc42bpa	UTSW	1	179961198	missense	probably damaging	1.00
R0268:Cdc42bpa	UTSW	1	180155782	intron	probably benign
R0472:Cdc42bpa	UTSW	1	180040179	missense	probably damaging	1.00
R0492:Cdc42bpa	UTSW	1	180101190	missense	probably benign	0.00
R0609:Cdc42bpa	UTSW	1	180040179	missense	probably damaging	1.00
R0691:Cdc42bpa	UTSW	1	180144835	missense	possibly damaging	0.91
R0738:Cdc42bpa	UTSW	1	179999462	splice site	probably benign
R1547:Cdc42bpa	UTSW	1	180074644	missense	probably damaging	0.99
R1553:Cdc42bpa	UTSW	1	180093975	missense	probably benign	0.01
R1601:Cdc42bpa	UTSW	1	180065001	nonsense	probably null
R1709:Cdc42bpa	UTSW	1	180067224	missense	probably damaging	1.00
R2101:Cdc42bpa	UTSW	1	180146968	missense	probably benign	0.39
R2279:Cdc42bpa	UTSW	1	180036919	missense	probably damaging	0.99
R2357:Cdc42bpa	UTSW	1	180067227	missense	possibly damaging	0.81
R2373:Cdc42bpa	UTSW	1	180111784	missense	possibly damaging	0.78
R2570:Cdc42bpa	UTSW	1	180150177	missense	possibly damaging	0.84
R3709:Cdc42bpa	UTSW	1	180065063	missense	probably damaging	1.00
R3710:Cdc42bpa	UTSW	1	180065063	missense	probably damaging	1.00
R3816:Cdc42bpa	UTSW	1	180144886	missense	possibly damaging	0.80
R3854:Cdc42bpa	UTSW	1	180155978	intron	probably benign
R3855:Cdc42bpa	UTSW	1	180155978	intron	probably benign
R3917:Cdc42bpa	UTSW	1	180106154	critical splice donor site	probably null
R4604:Cdc42bpa	UTSW	1	180109194	missense	probably benign	0.00
R4622:Cdc42bpa	UTSW	1	180074658	missense	probably damaging	0.98
R4664:Cdc42bpa	UTSW	1	180144565	missense	probably damaging	0.99
R4665:Cdc42bpa	UTSW	1	180144565	missense	probably damaging	0.99
R4887:Cdc42bpa	UTSW	1	180144635	missense	possibly damaging	0.61
R4989:Cdc42bpa	UTSW	1	180137801	missense	probably damaging	0.99
R5033:Cdc42bpa	UTSW	1	180065015	missense	probably damaging	1.00
R5050:Cdc42bpa	UTSW	1	180072453	nonsense	probably null
R5077:Cdc42bpa	UTSW	1	180094533	intron	probably benign
R5276:Cdc42bpa	UTSW	1	180137850	missense	probably damaging	1.00
R5313:Cdc42bpa	UTSW	1	180084433	missense	probably benign
R5364:Cdc42bpa	UTSW	1	180067182	missense	probably benign	0.06
R5372:Cdc42bpa	UTSW	1	180064979	missense	probably damaging	1.00
R5405:Cdc42bpa	UTSW	1	180067329	missense	probably damaging	1.00
R5405:Cdc42bpa	UTSW	1	180138520	missense	possibly damaging	0.95
R5646:Cdc42bpa	UTSW	1	180106094	missense	probably damaging	0.99
R5713:Cdc42bpa	UTSW	1	180084410	missense	probably benign	0.03
R6012:Cdc42bpa	UTSW	1	180065090	missense	probably damaging	1.00
R6029:Cdc42bpa	UTSW	1	180111787	missense	probably damaging	1.00
R6378:Cdc42bpa	UTSW	1	180093996	missense	possibly damaging	0.91
R6609:Cdc42bpa	UTSW	1	180101274	critical splice donor site	probably null
R7122:Cdc42bpa	UTSW	1	180065018	missense	probably damaging	1.00
R7289:Cdc42bpa	UTSW	1	180061797	nonsense	probably null
R7670:Cdc42bpa	UTSW	1	180065081	missense	probably damaging	1.00
R7912:Cdc42bpa	UTSW	1	180094013	missense	probably damaging	1.00
R8139:Cdc42bpa	UTSW	1	180069319	missense	probably damaging	1.00
R8362:Cdc42bpa	UTSW	1	180162125	missense	probably damaging	0.98
R8378:Cdc42bpa	UTSW	1	180162144	missense	probably damaging	0.98
R8794:Cdc42bpa	UTSW	1	180067251	missense	probably damaging	1.00
R8835:Cdc42bpa	UTSW	1	180069351	missense	probably damaging	1.00
R8896:Cdc42bpa	UTSW	1	180130808	intron	probably benign
R9012:Cdc42bpa	UTSW	1	180031512	missense
R9110:Cdc42bpa	UTSW	1	180117693	missense	possibly damaging	0.67
R9178:Cdc42bpa	UTSW	1	180130836	missense
R9184:Cdc42bpa	UTSW	1	180144736	missense	probably benign	0.13
R9204:Cdc42bpa	UTSW	1	180111895	critical splice donor site	probably null
R9227:Cdc42bpa	UTSW	1	180106073	missense	probably benign
R9230:Cdc42bpa	UTSW	1	180106073	missense	probably benign
R9299:Cdc42bpa	UTSW	1	180144508	missense	probably damaging	1.00
R9366:Cdc42bpa	UTSW	1	180094110	missense	probably damaging	1.00
R9381:Cdc42bpa	UTSW	1	180141483	missense	probably damaging	0.97
R9461:Cdc42bpa	UTSW	1	180142296	missense	probably damaging	1.00
R9559:Cdc42bpa	UTSW	1	180111894	critical splice donor site	probably null
X0026:Cdc42bpa	UTSW	1	179961198	missense	probably damaging	1.00
Z1176:Cdc42bpa	UTSW	1	180065093	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATGTGCTAATGGTTTTGACTACTG -3'
(R):5'- AAATGCCATCATACTCTGTTCTGC -3'

Sequencing Primer
(F):5'- GCTAATGGTTTTGACTACTGTTTCAG -3'
(R):5'- ACCATTTACAAGAAGATCCATTCTG -3'

Posted On

2016-07-06