Incidental Mutation 'R5196:Olfr1176'
ID400219
Institutional Source Beutler Lab
Gene Symbol Olfr1176
Ensembl Gene ENSMUSG00000050023
Gene Nameolfactory receptor 1176
SynonymsMOR174-5, GA_x6K02T2Q125-49824309-49825256
MMRRC Submission 042772-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5196 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88336721-88342048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88339748 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 61 (Y61C)
Ref Sequence ENSEMBL: ENSMUSP00000149943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057439] [ENSMUST00000137895] [ENSMUST00000213778] [ENSMUST00000216713]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057439
AA Change: Y61C

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000053353
Gene: ENSMUSG00000050023
AA Change: Y61C

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:7tm_4 32 309 5.3e-46 PFAM
Pfam:7tm_1 42 291 4.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137895
Predicted Effect possibly damaging
Transcript: ENSMUST00000213778
AA Change: Y61C

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000216713
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,796,438 T281A possibly damaging Het
4930503B20Rik A G 3: 146,646,263 probably benign Het
6330409D20Rik T A 2: 32,740,540 probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Amigo2 A G 15: 97,246,061 F160S probably damaging Het
Arcn1 A T 9: 44,760,027 L68M probably damaging Het
Arhgef25 A G 10: 127,185,109 S303P probably damaging Het
Asph A T 4: 9,607,830 S163T probably damaging Het
BC003331 T A 1: 150,382,389 D165V probably damaging Het
Birc6 T C 17: 74,606,141 probably benign Het
Ccm2 G A 11: 6,561,181 probably benign Het
Cdc42bpa T C 1: 180,072,413 V431A probably benign Het
Cdh7 T A 1: 110,138,000 M668K probably damaging Het
Cfap43 A T 19: 47,825,925 W157R probably damaging Het
Chrm5 T C 2: 112,480,384 Y129C probably damaging Het
Chrna5 A G 9: 55,006,519 I421V possibly damaging Het
Clk1 T A 1: 58,414,613 T301S probably benign Het
Col6a3 G T 1: 90,816,538 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam198a T G 9: 121,965,661 S294A probably benign Het
Fbxw19 T C 9: 109,484,428 Y234C probably benign Het
Fgd4 T A 16: 16,484,142 N183I probably benign Het
Fnip2 T C 3: 79,572,538 probably benign Het
Gm9847 T A 12: 14,495,015 noncoding transcript Het
H2-T23 A G 17: 36,032,607 probably null Het
Hdlbp T C 1: 93,420,193 E613G probably damaging Het
Kat6a G A 8: 22,911,713 R366H probably damaging Het
Kctd4 A G 14: 75,962,687 T33A probably benign Het
Klrb1c T A 6: 128,780,299 S268C probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrfip1 A G 1: 91,114,608 E245G probably damaging Het
Mast3 A T 8: 70,788,245 I220N probably damaging Het
Mfap3 A G 11: 57,529,813 T207A probably damaging Het
Mtdh G T 15: 34,118,004 K75N probably damaging Het
Mybpc1 A G 10: 88,536,351 Y806H probably damaging Het
Ntng1 T C 3: 109,934,983 D158G probably damaging Het
Olfr812 T A 10: 129,842,781 D87V possibly damaging Het
Pask A G 1: 93,310,083 probably benign Het
Pif1 G T 9: 65,588,092 A95S probably benign Het
Plppr2 T C 9: 21,941,132 F104S probably damaging Het
Prmt9 G A 8: 77,564,997 V333M probably benign Het
Pten A T 19: 32,815,497 M239L probably benign Het
Rb1cc1 A G 1: 6,234,230 D67G probably damaging Het
Reg2 T A 6: 78,405,547 L12* probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc5a7 C A 17: 54,281,722 probably null Het
Tcaf3 G T 6: 42,593,715 R368S probably benign Het
Tfcp2 A G 15: 100,520,714 V189A probably damaging Het
Uhrf1bp1 A G 17: 27,856,763 I5V probably benign Het
Wdr12 T C 1: 60,087,084 S191G probably damaging Het
Zfp536 G A 7: 37,480,760 R807W probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Olfr1176
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01736:Olfr1176 APN 2 88340427 missense probably damaging 1.00
IGL02166:Olfr1176 APN 2 88339678 missense probably damaging 0.97
IGL02340:Olfr1176 APN 2 88339562 unclassified probably benign
IGL02598:Olfr1176 APN 2 88340251 missense possibly damaging 0.64
IGL03069:Olfr1176 APN 2 88340299 unclassified probably null
IGL03212:Olfr1176 APN 2 88339672 missense probably damaging 1.00
R1959:Olfr1176 UTSW 2 88340201 missense probably damaging 1.00
R1960:Olfr1176 UTSW 2 88340201 missense probably damaging 1.00
R2907:Olfr1176 UTSW 2 88340483 missense probably benign 0.11
R2908:Olfr1176 UTSW 2 88340483 missense probably benign 0.11
R4049:Olfr1176 UTSW 2 88343800 unclassified probably null
R4257:Olfr1176 UTSW 2 88340277 missense probably damaging 1.00
R4823:Olfr1176 UTSW 2 88339835 missense probably damaging 0.96
R4897:Olfr1176 UTSW 2 88344342 missense possibly damaging 0.89
R5106:Olfr1176 UTSW 2 88340110 missense probably benign 0.07
R5192:Olfr1176 UTSW 2 88339748 missense possibly damaging 0.94
R5331:Olfr1176 UTSW 2 88339988 missense probably damaging 1.00
R5579:Olfr1176 UTSW 2 88340413 missense possibly damaging 0.83
R6283:Olfr1176 UTSW 2 88339658 missense probably benign 0.33
R6702:Olfr1176 UTSW 2 88340242 missense probably benign 0.02
R8155:Olfr1176 UTSW 2 88339952 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGAATCAGAGTACTGGAGTCG -3'
(R):5'- AGACATAGCCACTGTGTAGAGC -3'

Sequencing Primer
(F):5'- AATCAGAGTACTGGAGTCGTATTTG -3'
(R):5'- GCGATCATAGGCCATTACTGC -3'
Posted On2016-07-06