Incidental Mutation 'R0456:Fat1'
ID 40022
Institutional Source Beutler Lab
Gene Symbol Fat1
Ensembl Gene ENSMUSG00000070047
Gene Name FAT atypical cadherin 1
Synonyms 2310038E12Rik, mFat1, Fath
MMRRC Submission 038656-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0456 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 45388484-45505294 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 45482571 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 3077 (I3077F)
Ref Sequence ENSEMBL: ENSMUSP00000149194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098796] [ENSMUST00000189017] [ENSMUST00000191428] [ENSMUST00000215588]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000098796
AA Change: I3054F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096394
Gene: ENSMUSG00000070047
AA Change: I3054F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 62 148 3.05e-6 SMART
CA 172 256 3.29e-20 SMART
Blast:CA 277 382 5e-47 BLAST
CA 387 462 2.13e-5 SMART
CA 486 568 8.35e-22 SMART
CA 592 670 2.11e-2 SMART
CA 740 821 5.09e-26 SMART
CA 845 926 6.27e-26 SMART
CA 950 1031 4.07e-25 SMART
CA 1057 1138 5.13e-31 SMART
CA 1162 1244 8.79e-30 SMART
CA 1276 1351 2.06e-3 SMART
CA 1379 1456 1.63e-15 SMART
CA 1480 1562 3.29e-20 SMART
CA 1586 1667 2.34e-16 SMART
CA 1691 1765 1.16e-20 SMART
CA 1796 1879 6.27e-26 SMART
CA 1903 1979 1.47e-8 SMART
CA 2003 2081 2.65e-15 SMART
CA 2105 2181 2.14e-10 SMART
CA 2203 2283 9.82e-19 SMART
CA 2307 2390 7.54e-29 SMART
CA 2414 2492 3.29e-11 SMART
CA 2516 2596 6.48e-19 SMART
CA 2620 2703 3.48e-10 SMART
CA 2719 2809 2.26e-9 SMART
CA 2833 2918 8.08e-29 SMART
CA 2942 3023 5.99e-23 SMART
CA 3047 3125 2.63e-28 SMART
CA 3149 3230 2.79e-32 SMART
CA 3254 3335 5.25e-28 SMART
CA 3359 3440 4.46e-31 SMART
CA 3464 3545 1.25e-11 SMART
CA 3569 3641 5.67e-2 SMART
LamG 3853 3987 6.51e-36 SMART
EGF 4018 4052 8.57e-5 SMART
EGF 4057 4090 3.94e-4 SMART
EGF 4094 4127 4.29e-5 SMART
EGF_CA 4129 4165 1.81e-12 SMART
transmembrane domain 4182 4204 N/A INTRINSIC
low complexity region 4308 4324 N/A INTRINSIC
low complexity region 4436 4457 N/A INTRINSIC
low complexity region 4472 4483 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000189017
AA Change: I3054F
Predicted Effect probably damaging
Transcript: ENSMUST00000191428
AA Change: I3054F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140596
Gene: ENSMUSG00000070047
AA Change: I3054F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 62 148 3.05e-6 SMART
CA 172 256 3.29e-20 SMART
Blast:CA 277 382 5e-47 BLAST
CA 387 462 2.13e-5 SMART
CA 486 568 8.35e-22 SMART
CA 592 670 2.11e-2 SMART
CA 740 821 5.09e-26 SMART
CA 845 926 6.27e-26 SMART
CA 950 1031 4.07e-25 SMART
CA 1057 1138 5.13e-31 SMART
CA 1162 1244 8.79e-30 SMART
CA 1276 1351 2.06e-3 SMART
CA 1379 1456 1.63e-15 SMART
CA 1480 1562 3.29e-20 SMART
CA 1586 1667 2.34e-16 SMART
CA 1691 1765 1.16e-20 SMART
CA 1796 1879 6.27e-26 SMART
CA 1903 1979 1.47e-8 SMART
CA 2003 2081 2.65e-15 SMART
CA 2105 2181 2.14e-10 SMART
CA 2203 2283 9.82e-19 SMART
CA 2307 2390 7.54e-29 SMART
CA 2414 2492 3.29e-11 SMART
CA 2516 2596 6.48e-19 SMART
CA 2620 2703 3.48e-10 SMART
CA 2719 2809 2.26e-9 SMART
CA 2833 2918 8.08e-29 SMART
CA 2942 3023 5.99e-23 SMART
CA 3047 3125 2.63e-28 SMART
CA 3149 3230 2.79e-32 SMART
CA 3254 3335 5.25e-28 SMART
CA 3359 3440 4.46e-31 SMART
CA 3464 3545 1.25e-11 SMART
CA 3569 3641 5.67e-2 SMART
LamG 3853 3987 6.51e-36 SMART
EGF 4018 4052 8.57e-5 SMART
EGF 4057 4090 3.94e-4 SMART
EGF 4094 4127 4.29e-5 SMART
EGF_CA 4129 4165 1.81e-12 SMART
transmembrane domain 4182 4204 N/A INTRINSIC
low complexity region 4308 4324 N/A INTRINSIC
low complexity region 4436 4457 N/A INTRINSIC
low complexity region 4472 4483 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215588
AA Change: I3077F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an ortholog of the Drosophila fat gene, which encodes a tumor suppressor essential for controlling cell proliferation during Drosophila development. The gene product is a member of the cadherin superfamily, a group of integral membrane proteins characterized by the presence of cadherin-type repeats. In addition to containing 34 tandem cadherin-type repeats, the gene product has five epidermal growth factor (EGF)-like repeats and one laminin A-G domain. This gene is expressed at high levels in a number of fetal epithelia. Its product probably functions as an adhesion molecule and/or signaling receptor, and is likely to be important in developmental processes and cell communication. Transcript variants derived from alternative splicing and/or alternative promoter usage exist, but they have not been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit holoprosencephaly, anophthalmia, kidney defects and perinatal lethality. Mice homozygous for a hypomorphic allele exhibit altered shoulder girdle and facial musculature, retinal defects, abnormal inner earpatterning and kidney defects. [provided by MGI curators]
Allele List at MGI

All alleles(56) : Targeted, other(1) Gene trapped(55)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 G A 18: 12,429,036 (GRCm39) P11L probably damaging Het
Antxr1 A C 6: 87,194,257 (GRCm39) V347G probably damaging Het
Atp13a5 T C 16: 29,051,492 (GRCm39) N1127D probably benign Het
Bivm T A 1: 44,165,969 (GRCm39) W140R probably damaging Het
Camta1 C A 4: 151,159,597 (GRCm39) R1614L probably damaging Het
Ceacam5 T C 7: 17,494,776 (GRCm39) V928A possibly damaging Het
Chia1 T C 3: 106,035,795 (GRCm39) Y152H probably damaging Het
Chsy3 A T 18: 59,309,550 (GRCm39) I268F probably damaging Het
CK137956 A T 4: 127,839,100 (GRCm39) N439K probably damaging Het
Csf3r C A 4: 125,929,654 (GRCm39) N392K probably damaging Het
Cyp1b1 T C 17: 80,017,704 (GRCm39) I484V probably benign Het
Dsc1 T C 18: 20,232,169 (GRCm39) K280E probably damaging Het
Eefsec A G 6: 88,274,870 (GRCm39) Y365H probably benign Het
Epb41l4b C T 4: 57,142,843 (GRCm39) probably null Het
Erap1 G A 13: 74,812,339 (GRCm39) V385I probably benign Het
Fras1 T G 5: 96,862,202 (GRCm39) probably null Het
Fras1 G T 5: 96,702,647 (GRCm39) G230C probably damaging Het
Gsg1l A G 7: 125,522,682 (GRCm39) M182T possibly damaging Het
Gzmg A G 14: 56,395,779 (GRCm39) V60A probably damaging Het
H4c6 T C 13: 23,735,561 (GRCm39) D86G probably damaging Het
Hapln4 A T 8: 70,537,645 (GRCm39) Y113F probably benign Het
Ikzf4 T A 10: 128,471,677 (GRCm39) T274S probably damaging Het
Kansl1l T A 1: 66,774,885 (GRCm39) H302L probably damaging Het
Klhl41 T C 2: 69,500,893 (GRCm39) V118A probably damaging Het
Kpna1 T C 16: 35,823,270 (GRCm39) S41P possibly damaging Het
Krt23 A G 11: 99,377,604 (GRCm39) V134A probably benign Het
Lamb1 G A 12: 31,354,729 (GRCm39) C992Y probably damaging Het
Lrif1 C T 3: 106,639,094 (GRCm39) P35S probably benign Het
Lrrc4 A G 6: 28,831,103 (GRCm39) S171P probably damaging Het
Lvrn G A 18: 46,997,883 (GRCm39) probably null Het
Matr3 T A 18: 35,705,917 (GRCm39) F281I probably damaging Het
Meak7 A T 8: 120,495,162 (GRCm39) F199I probably damaging Het
Nxn G A 11: 76,153,963 (GRCm39) Q291* probably null Het
Or5b113 A G 19: 13,342,102 (GRCm39) T37A probably damaging Het
Pdp2 G T 8: 105,320,421 (GRCm39) R90L probably damaging Het
Ppp1r3c C A 19: 36,711,291 (GRCm39) E160* probably null Het
Ppp2r5c T G 12: 110,489,013 (GRCm39) S118R probably damaging Het
Ptpn23 G T 9: 110,218,861 (GRCm39) probably null Het
Ptpro G T 6: 137,391,228 (GRCm39) V783L probably benign Het
Rab40c A G 17: 26,103,631 (GRCm39) V144A possibly damaging Het
Rasal2 T C 1: 156,977,413 (GRCm39) N1087S probably damaging Het
Rfc3 T A 5: 151,570,988 (GRCm39) S103C possibly damaging Het
Rgl2 A G 17: 34,155,823 (GRCm39) probably null Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rit2 A T 18: 31,108,504 (GRCm39) F160L probably benign Het
Rnh1 A G 7: 140,742,461 (GRCm39) S366P possibly damaging Het
Sdk2 T C 11: 113,682,292 (GRCm39) Y2029C possibly damaging Het
Smpd3 T A 8: 106,986,288 (GRCm39) I505F probably benign Het
Sorcs3 A T 19: 48,642,483 (GRCm39) S379C possibly damaging Het
Sult1e1 A G 5: 87,726,493 (GRCm39) L207P possibly damaging Het
Sycp2 C G 2: 178,023,648 (GRCm39) S456T probably benign Het
Syne1 T C 10: 5,292,252 (GRCm39) T1339A probably benign Het
Tas2r117 A G 6: 132,780,354 (GRCm39) N164S probably benign Het
Tigd3 A G 19: 5,942,821 (GRCm39) L103P probably damaging Het
Tmem132b T C 5: 125,864,788 (GRCm39) S965P probably damaging Het
Tmem82 T C 4: 141,344,701 (GRCm39) T81A probably benign Het
Tmem8b A G 4: 43,685,618 (GRCm39) T156A probably benign Het
Tnfrsf21 A G 17: 43,348,982 (GRCm39) E198G probably benign Het
Tnpo2 A G 8: 85,781,045 (GRCm39) N767S probably damaging Het
Trf T C 9: 103,104,102 (GRCm39) Y87C probably damaging Het
Tst A G 15: 78,289,780 (GRCm39) V85A probably damaging Het
Usp37 A T 1: 74,507,507 (GRCm39) N503K probably damaging Het
Utp20 C T 10: 88,590,435 (GRCm39) M2346I possibly damaging Het
Vax2 A G 6: 83,688,388 (GRCm39) D37G probably benign Het
Vmn1r77 T A 7: 11,775,665 (GRCm39) L79* probably null Het
Zbtb3 A T 19: 8,780,564 (GRCm39) D59V probably damaging Het
Zdhhc13 T C 7: 48,458,602 (GRCm39) F182S probably benign Het
Zfp426 A G 9: 20,381,593 (GRCm39) F465L probably damaging Het
Zfp526 A G 7: 24,925,637 (GRCm39) E632G probably damaging Het
Other mutations in Fat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Fat1 APN 8 45,477,639 (GRCm39) missense possibly damaging 0.93
IGL00157:Fat1 APN 8 45,404,707 (GRCm39) missense possibly damaging 0.96
IGL00481:Fat1 APN 8 45,503,977 (GRCm39) missense probably benign 0.18
IGL00983:Fat1 APN 8 45,486,427 (GRCm39) missense probably damaging 1.00
IGL01089:Fat1 APN 8 45,470,894 (GRCm39) missense probably damaging 1.00
IGL01135:Fat1 APN 8 45,477,877 (GRCm39) missense probably damaging 1.00
IGL01143:Fat1 APN 8 45,488,569 (GRCm39) missense possibly damaging 0.72
IGL01155:Fat1 APN 8 45,476,986 (GRCm39) missense probably damaging 1.00
IGL01376:Fat1 APN 8 45,479,878 (GRCm39) missense probably benign 0.00
IGL01411:Fat1 APN 8 45,479,837 (GRCm39) missense probably damaging 1.00
IGL01443:Fat1 APN 8 45,493,613 (GRCm39) missense probably damaging 1.00
IGL01453:Fat1 APN 8 45,504,307 (GRCm39) missense probably damaging 1.00
IGL01606:Fat1 APN 8 45,476,086 (GRCm39) missense probably benign 0.26
IGL01622:Fat1 APN 8 45,482,592 (GRCm39) missense possibly damaging 0.64
IGL01623:Fat1 APN 8 45,482,592 (GRCm39) missense possibly damaging 0.64
IGL01672:Fat1 APN 8 45,493,737 (GRCm39) missense probably benign 0.05
IGL01735:Fat1 APN 8 45,489,276 (GRCm39) missense probably benign 0.07
IGL01793:Fat1 APN 8 45,442,149 (GRCm39) missense probably benign
IGL01820:Fat1 APN 8 45,463,539 (GRCm39) missense probably damaging 1.00
IGL01969:Fat1 APN 8 45,405,636 (GRCm39) missense probably damaging 0.98
IGL02012:Fat1 APN 8 45,480,577 (GRCm39) missense possibly damaging 0.95
IGL02227:Fat1 APN 8 45,476,696 (GRCm39) missense probably damaging 1.00
IGL02256:Fat1 APN 8 45,403,369 (GRCm39) missense probably damaging 1.00
IGL02273:Fat1 APN 8 45,403,368 (GRCm39) missense probably damaging 1.00
IGL02317:Fat1 APN 8 45,478,855 (GRCm39) missense probably benign 0.33
IGL02324:Fat1 APN 8 45,493,593 (GRCm39) missense probably damaging 1.00
IGL02336:Fat1 APN 8 45,404,620 (GRCm39) missense probably benign 0.16
IGL02442:Fat1 APN 8 45,403,360 (GRCm39) missense probably benign 0.02
IGL02486:Fat1 APN 8 45,478,109 (GRCm39) missense probably benign 0.16
IGL02551:Fat1 APN 8 45,504,435 (GRCm39) missense probably damaging 1.00
IGL02617:Fat1 APN 8 45,488,628 (GRCm39) missense probably benign 0.31
IGL02698:Fat1 APN 8 45,476,201 (GRCm39) missense probably benign
IGL02885:Fat1 APN 8 45,442,204 (GRCm39) missense probably benign 0.01
IGL02904:Fat1 APN 8 45,493,719 (GRCm39) missense probably damaging 1.00
IGL02953:Fat1 APN 8 45,477,351 (GRCm39) missense probably damaging 1.00
IGL03108:Fat1 APN 8 45,476,651 (GRCm39) missense probably damaging 1.00
IGL03153:Fat1 APN 8 45,483,160 (GRCm39) missense possibly damaging 0.83
IGL03183:Fat1 APN 8 45,403,623 (GRCm39) missense probably damaging 0.99
IGL03327:Fat1 APN 8 45,403,505 (GRCm39) missense probably damaging 1.00
IGL03405:Fat1 APN 8 45,478,278 (GRCm39) missense probably damaging 1.00
Laggardly UTSW 8 45,497,501 (GRCm39) missense probably damaging 1.00
R2257_fat1_465 UTSW 8 45,403,408 (GRCm39) missense probably damaging 1.00
Shrinkage UTSW 8 45,471,074 (GRCm39) missense probably damaging 1.00
F5493:Fat1 UTSW 8 45,478,517 (GRCm39) missense probably damaging 0.99
G1citation:Fat1 UTSW 8 45,479,441 (GRCm39) missense probably damaging 1.00
I2289:Fat1 UTSW 8 45,478,033 (GRCm39) missense probably benign 0.01
IGL02837:Fat1 UTSW 8 45,470,471 (GRCm39) missense probably benign 0.00
PIT4283001:Fat1 UTSW 8 45,490,244 (GRCm39) missense probably damaging 1.00
PIT4283001:Fat1 UTSW 8 45,482,577 (GRCm39) missense probably damaging 1.00
PIT4576001:Fat1 UTSW 8 45,477,682 (GRCm39) missense probably damaging 1.00
R0040:Fat1 UTSW 8 45,479,441 (GRCm39) missense probably damaging 1.00
R0040:Fat1 UTSW 8 45,479,441 (GRCm39) missense probably damaging 1.00
R0078:Fat1 UTSW 8 45,406,336 (GRCm39) missense probably damaging 1.00
R0197:Fat1 UTSW 8 45,479,590 (GRCm39) missense probably benign 0.00
R0328:Fat1 UTSW 8 45,476,827 (GRCm39) missense probably benign 0.35
R0367:Fat1 UTSW 8 45,477,350 (GRCm39) missense probably damaging 1.00
R0371:Fat1 UTSW 8 45,404,929 (GRCm39) missense probably damaging 1.00
R0380:Fat1 UTSW 8 45,463,160 (GRCm39) missense probably damaging 0.97
R0389:Fat1 UTSW 8 45,403,385 (GRCm39) missense probably benign 0.00
R0433:Fat1 UTSW 8 45,477,686 (GRCm39) missense possibly damaging 0.51
R0494:Fat1 UTSW 8 45,403,579 (GRCm39) missense probably damaging 1.00
R0506:Fat1 UTSW 8 45,475,988 (GRCm39) missense probably damaging 0.99
R0512:Fat1 UTSW 8 45,404,369 (GRCm39) nonsense probably null
R0624:Fat1 UTSW 8 45,504,205 (GRCm39) missense possibly damaging 0.46
R0701:Fat1 UTSW 8 45,479,590 (GRCm39) missense probably benign 0.00
R0723:Fat1 UTSW 8 45,479,786 (GRCm39) missense probably damaging 1.00
R0787:Fat1 UTSW 8 45,493,592 (GRCm39) missense probably damaging 1.00
R0788:Fat1 UTSW 8 45,477,020 (GRCm39) missense probably benign 0.27
R0862:Fat1 UTSW 8 45,471,074 (GRCm39) missense probably damaging 1.00
R0864:Fat1 UTSW 8 45,471,074 (GRCm39) missense probably damaging 1.00
R0907:Fat1 UTSW 8 45,479,635 (GRCm39) missense probably benign 0.08
R0962:Fat1 UTSW 8 45,486,363 (GRCm39) splice site probably benign
R1051:Fat1 UTSW 8 45,497,543 (GRCm39) missense probably damaging 1.00
R1156:Fat1 UTSW 8 45,492,927 (GRCm39) missense possibly damaging 0.94
R1237:Fat1 UTSW 8 45,497,316 (GRCm39) missense probably damaging 1.00
R1468:Fat1 UTSW 8 45,463,582 (GRCm39) missense probably damaging 1.00
R1468:Fat1 UTSW 8 45,463,582 (GRCm39) missense probably damaging 1.00
R1478:Fat1 UTSW 8 45,478,659 (GRCm39) missense probably damaging 0.99
R1482:Fat1 UTSW 8 45,406,281 (GRCm39) missense probably benign 0.04
R1496:Fat1 UTSW 8 45,486,427 (GRCm39) missense probably damaging 1.00
R1498:Fat1 UTSW 8 45,478,521 (GRCm39) nonsense probably null
R1508:Fat1 UTSW 8 45,479,899 (GRCm39) missense probably benign 0.01
R1577:Fat1 UTSW 8 45,476,420 (GRCm39) missense probably benign 0.30
R1646:Fat1 UTSW 8 45,471,079 (GRCm39) missense probably damaging 1.00
R1652:Fat1 UTSW 8 45,478,215 (GRCm39) nonsense probably null
R1656:Fat1 UTSW 8 45,478,567 (GRCm39) nonsense probably null
R1662:Fat1 UTSW 8 45,406,201 (GRCm39) missense probably benign 0.20
R1672:Fat1 UTSW 8 45,489,872 (GRCm39) missense probably damaging 1.00
R1704:Fat1 UTSW 8 45,478,613 (GRCm39) missense probably damaging 1.00
R1708:Fat1 UTSW 8 45,477,829 (GRCm39) missense probably damaging 1.00
R1710:Fat1 UTSW 8 45,463,519 (GRCm39) missense probably benign 0.00
R1812:Fat1 UTSW 8 45,489,840 (GRCm39) missense probably damaging 1.00
R1872:Fat1 UTSW 8 45,491,386 (GRCm39) missense probably damaging 1.00
R1872:Fat1 UTSW 8 45,406,341 (GRCm39) missense probably benign 0.01
R1883:Fat1 UTSW 8 45,504,184 (GRCm39) missense probably benign 0.17
R1893:Fat1 UTSW 8 45,476,893 (GRCm39) missense probably damaging 1.00
R1930:Fat1 UTSW 8 45,497,265 (GRCm39) missense possibly damaging 0.91
R1931:Fat1 UTSW 8 45,497,265 (GRCm39) missense possibly damaging 0.91
R1952:Fat1 UTSW 8 45,486,963 (GRCm39) missense probably benign 0.00
R1957:Fat1 UTSW 8 45,493,719 (GRCm39) missense probably damaging 1.00
R1999:Fat1 UTSW 8 45,405,430 (GRCm39) missense probably damaging 0.96
R2019:Fat1 UTSW 8 45,476,783 (GRCm39) missense probably damaging 1.00
R2062:Fat1 UTSW 8 45,477,369 (GRCm39) missense probably damaging 1.00
R2062:Fat1 UTSW 8 45,479,741 (GRCm39) missense probably damaging 1.00
R2117:Fat1 UTSW 8 45,490,500 (GRCm39) missense probably benign 0.33
R2196:Fat1 UTSW 8 45,477,683 (GRCm39) missense probably damaging 1.00
R2204:Fat1 UTSW 8 45,476,737 (GRCm39) missense probably damaging 1.00
R2256:Fat1 UTSW 8 45,403,408 (GRCm39) missense probably damaging 1.00
R2257:Fat1 UTSW 8 45,403,408 (GRCm39) missense probably damaging 1.00
R2409:Fat1 UTSW 8 45,493,567 (GRCm39) splice site probably benign
R2416:Fat1 UTSW 8 45,479,420 (GRCm39) missense probably damaging 1.00
R3021:Fat1 UTSW 8 45,497,048 (GRCm39) missense probably damaging 1.00
R3108:Fat1 UTSW 8 45,498,210 (GRCm39) splice site probably null
R3109:Fat1 UTSW 8 45,498,210 (GRCm39) splice site probably null
R3196:Fat1 UTSW 8 45,404,905 (GRCm39) missense probably benign 0.00
R3683:Fat1 UTSW 8 45,470,975 (GRCm39) missense probably benign
R3732:Fat1 UTSW 8 45,406,306 (GRCm39) missense possibly damaging 0.85
R3732:Fat1 UTSW 8 45,406,306 (GRCm39) missense possibly damaging 0.85
R3733:Fat1 UTSW 8 45,406,306 (GRCm39) missense possibly damaging 0.85
R3753:Fat1 UTSW 8 45,478,516 (GRCm39) missense probably damaging 0.97
R3905:Fat1 UTSW 8 45,476,072 (GRCm39) missense probably benign 0.00
R3907:Fat1 UTSW 8 45,476,072 (GRCm39) missense probably benign 0.00
R3908:Fat1 UTSW 8 45,476,072 (GRCm39) missense probably benign 0.00
R4060:Fat1 UTSW 8 45,478,518 (GRCm39) missense probably benign 0.09
R4061:Fat1 UTSW 8 45,478,518 (GRCm39) missense probably benign 0.09
R4062:Fat1 UTSW 8 45,478,518 (GRCm39) missense probably benign 0.09
R4063:Fat1 UTSW 8 45,478,518 (GRCm39) missense probably benign 0.09
R4078:Fat1 UTSW 8 45,442,159 (GRCm39) missense probably damaging 0.99
R4105:Fat1 UTSW 8 45,489,888 (GRCm39) missense probably damaging 1.00
R4118:Fat1 UTSW 8 45,503,981 (GRCm39) missense probably damaging 1.00
R4118:Fat1 UTSW 8 45,463,474 (GRCm39) missense probably damaging 1.00
R4161:Fat1 UTSW 8 45,489,824 (GRCm39) missense probably benign 0.00
R4364:Fat1 UTSW 8 45,405,999 (GRCm39) missense probably benign 0.01
R4394:Fat1 UTSW 8 45,405,383 (GRCm39) missense probably damaging 0.98
R4395:Fat1 UTSW 8 45,405,383 (GRCm39) missense probably damaging 0.98
R4396:Fat1 UTSW 8 45,405,383 (GRCm39) missense probably damaging 0.98
R4412:Fat1 UTSW 8 45,476,636 (GRCm39) missense probably damaging 0.99
R4542:Fat1 UTSW 8 45,494,931 (GRCm39) missense probably damaging 1.00
R4591:Fat1 UTSW 8 45,479,279 (GRCm39) missense probably benign
R4606:Fat1 UTSW 8 45,403,720 (GRCm39) missense possibly damaging 0.47
R4612:Fat1 UTSW 8 45,478,184 (GRCm39) missense probably damaging 1.00
R4730:Fat1 UTSW 8 45,486,514 (GRCm39) missense probably damaging 1.00
R4778:Fat1 UTSW 8 45,491,363 (GRCm39) missense probably benign 0.04
R4824:Fat1 UTSW 8 45,442,151 (GRCm39) missense probably damaging 1.00
R4829:Fat1 UTSW 8 45,489,199 (GRCm39) missense probably damaging 1.00
R4832:Fat1 UTSW 8 45,466,102 (GRCm39) missense possibly damaging 0.95
R4849:Fat1 UTSW 8 45,466,007 (GRCm39) missense probably benign 0.15
R4896:Fat1 UTSW 8 45,404,317 (GRCm39) missense possibly damaging 0.68
R4927:Fat1 UTSW 8 45,476,000 (GRCm39) missense probably damaging 0.96
R4941:Fat1 UTSW 8 45,489,312 (GRCm39) missense probably benign 0.00
R5011:Fat1 UTSW 8 45,484,300 (GRCm39) critical splice acceptor site probably null
R5040:Fat1 UTSW 8 45,476,417 (GRCm39) missense probably damaging 1.00
R5112:Fat1 UTSW 8 45,477,319 (GRCm39) missense probably damaging 1.00
R5151:Fat1 UTSW 8 45,404,851 (GRCm39) missense possibly damaging 0.74
R5161:Fat1 UTSW 8 45,405,549 (GRCm39) missense probably benign 0.00
R5162:Fat1 UTSW 8 45,478,846 (GRCm39) missense probably benign 0.02
R5353:Fat1 UTSW 8 45,489,168 (GRCm39) missense probably benign 0.13
R5425:Fat1 UTSW 8 45,478,922 (GRCm39) missense possibly damaging 0.64
R5458:Fat1 UTSW 8 45,466,090 (GRCm39) missense probably damaging 1.00
R5479:Fat1 UTSW 8 45,489,912 (GRCm39) missense possibly damaging 0.88
R5543:Fat1 UTSW 8 45,476,516 (GRCm39) missense probably damaging 0.99
R5569:Fat1 UTSW 8 45,492,873 (GRCm39) missense probably damaging 0.98
R5610:Fat1 UTSW 8 45,406,109 (GRCm39) nonsense probably null
R5734:Fat1 UTSW 8 45,504,246 (GRCm39) missense probably damaging 0.99
R5832:Fat1 UTSW 8 45,470,460 (GRCm39) missense possibly damaging 0.65
R5860:Fat1 UTSW 8 45,504,166 (GRCm39) missense probably benign
R5886:Fat1 UTSW 8 45,486,432 (GRCm39) missense probably damaging 1.00
R5886:Fat1 UTSW 8 45,480,718 (GRCm39) critical splice donor site probably null
R5919:Fat1 UTSW 8 45,479,910 (GRCm39) critical splice donor site probably null
R5930:Fat1 UTSW 8 45,497,073 (GRCm39) missense probably benign 0.10
R5960:Fat1 UTSW 8 45,486,405 (GRCm39) missense probably damaging 1.00
R5988:Fat1 UTSW 8 45,482,493 (GRCm39) missense probably benign 0.00
R6166:Fat1 UTSW 8 45,405,522 (GRCm39) missense probably damaging 1.00
R6184:Fat1 UTSW 8 45,406,429 (GRCm39) missense probably benign 0.00
R6208:Fat1 UTSW 8 45,480,650 (GRCm39) missense probably damaging 0.99
R6351:Fat1 UTSW 8 45,486,532 (GRCm39) missense probably damaging 1.00
R6391:Fat1 UTSW 8 45,405,379 (GRCm39) missense possibly damaging 0.69
R6701:Fat1 UTSW 8 45,403,718 (GRCm39) missense probably damaging 1.00
R6702:Fat1 UTSW 8 45,406,083 (GRCm39) missense probably benign 0.28
R6703:Fat1 UTSW 8 45,406,083 (GRCm39) missense probably benign 0.28
R6704:Fat1 UTSW 8 45,477,410 (GRCm39) missense probably damaging 1.00
R6822:Fat1 UTSW 8 45,479,441 (GRCm39) missense probably damaging 1.00
R6852:Fat1 UTSW 8 45,488,635 (GRCm39) missense possibly damaging 0.46
R6863:Fat1 UTSW 8 45,497,501 (GRCm39) missense probably damaging 1.00
R6885:Fat1 UTSW 8 45,405,489 (GRCm39) missense possibly damaging 0.94
R6912:Fat1 UTSW 8 45,504,060 (GRCm39) missense probably benign 0.00
R6927:Fat1 UTSW 8 45,477,532 (GRCm39) missense probably benign 0.41
R6964:Fat1 UTSW 8 45,496,982 (GRCm39) missense probably damaging 1.00
R7010:Fat1 UTSW 8 45,406,386 (GRCm39) nonsense probably null
R7062:Fat1 UTSW 8 45,403,253 (GRCm39) start codon destroyed probably null 0.99
R7063:Fat1 UTSW 8 45,493,812 (GRCm39) missense probably benign 0.09
R7071:Fat1 UTSW 8 45,442,145 (GRCm39) missense possibly damaging 0.67
R7117:Fat1 UTSW 8 45,484,505 (GRCm39) missense probably damaging 0.98
R7146:Fat1 UTSW 8 45,403,962 (GRCm39) missense probably benign
R7210:Fat1 UTSW 8 45,476,540 (GRCm39) missense probably damaging 1.00
R7227:Fat1 UTSW 8 45,463,646 (GRCm39) missense probably benign 0.08
R7270:Fat1 UTSW 8 45,490,475 (GRCm39) missense probably damaging 1.00
R7373:Fat1 UTSW 8 45,479,702 (GRCm39) missense probably damaging 1.00
R7390:Fat1 UTSW 8 45,405,511 (GRCm39) missense possibly damaging 0.81
R7465:Fat1 UTSW 8 45,497,189 (GRCm39) missense probably benign 0.35
R7476:Fat1 UTSW 8 45,484,311 (GRCm39) missense probably benign 0.01
R7483:Fat1 UTSW 8 45,476,197 (GRCm39) missense probably benign 0.13
R7484:Fat1 UTSW 8 45,489,221 (GRCm39) missense probably damaging 1.00
R7526:Fat1 UTSW 8 45,476,464 (GRCm39) missense probably damaging 1.00
R7549:Fat1 UTSW 8 45,442,031 (GRCm39) missense probably benign 0.01
R7554:Fat1 UTSW 8 45,490,202 (GRCm39) missense possibly damaging 0.88
R7620:Fat1 UTSW 8 45,462,887 (GRCm39) missense possibly damaging 0.95
R7652:Fat1 UTSW 8 45,406,336 (GRCm39) missense probably damaging 1.00
R7694:Fat1 UTSW 8 45,441,967 (GRCm39) critical splice acceptor site probably null
R7746:Fat1 UTSW 8 45,404,670 (GRCm39) missense probably damaging 0.96
R7762:Fat1 UTSW 8 45,490,374 (GRCm39) missense probably damaging 0.99
R7762:Fat1 UTSW 8 45,476,359 (GRCm39) missense probably damaging 1.00
R7782:Fat1 UTSW 8 45,403,948 (GRCm39) missense probably damaging 1.00
R7801:Fat1 UTSW 8 45,495,260 (GRCm39) missense probably damaging 1.00
R7807:Fat1 UTSW 8 45,495,010 (GRCm39) missense probably damaging 1.00
R7821:Fat1 UTSW 8 45,403,261 (GRCm39) missense probably benign
R7869:Fat1 UTSW 8 45,504,259 (GRCm39) missense probably benign 0.02
R8034:Fat1 UTSW 8 45,404,728 (GRCm39) missense probably benign 0.28
R8094:Fat1 UTSW 8 45,405,739 (GRCm39) missense probably damaging 0.98
R8111:Fat1 UTSW 8 45,479,095 (GRCm39) missense possibly damaging 0.94
R8220:Fat1 UTSW 8 45,492,993 (GRCm39) missense probably null
R8221:Fat1 UTSW 8 45,406,390 (GRCm39) missense
R8233:Fat1 UTSW 8 45,405,055 (GRCm39) missense
R8250:Fat1 UTSW 8 45,406,336 (GRCm39) missense probably damaging 1.00
R8279:Fat1 UTSW 8 45,483,384 (GRCm39) critical splice donor site probably null
R8726:Fat1 UTSW 8 45,477,206 (GRCm39) missense probably benign 0.23
R8875:Fat1 UTSW 8 45,493,600 (GRCm39) missense probably damaging 1.00
R8937:Fat1 UTSW 8 45,483,350 (GRCm39) missense probably damaging 1.00
R8950:Fat1 UTSW 8 45,476,158 (GRCm39) missense probably damaging 1.00
R8971:Fat1 UTSW 8 45,495,331 (GRCm39) missense probably damaging 1.00
R8976:Fat1 UTSW 8 45,484,332 (GRCm39) missense probably benign 0.02
R9000:Fat1 UTSW 8 45,497,587 (GRCm39) nonsense probably null
R9032:Fat1 UTSW 8 45,492,894 (GRCm39) missense probably benign 0.01
R9076:Fat1 UTSW 8 45,492,938 (GRCm39) missense probably damaging 1.00
R9083:Fat1 UTSW 8 45,491,336 (GRCm39) missense probably benign 0.00
R9083:Fat1 UTSW 8 45,466,127 (GRCm39) missense possibly damaging 0.76
R9103:Fat1 UTSW 8 45,404,850 (GRCm39) missense probably benign 0.38
R9124:Fat1 UTSW 8 45,478,064 (GRCm39) missense possibly damaging 0.48
R9124:Fat1 UTSW 8 45,403,363 (GRCm39) missense probably benign
R9128:Fat1 UTSW 8 45,462,878 (GRCm39) missense probably benign 0.14
R9148:Fat1 UTSW 8 45,405,682 (GRCm39) missense possibly damaging 0.81
R9162:Fat1 UTSW 8 45,404,352 (GRCm39) missense probably damaging 1.00
R9209:Fat1 UTSW 8 45,404,791 (GRCm39) missense possibly damaging 0.80
R9276:Fat1 UTSW 8 45,488,514 (GRCm39) missense probably damaging 0.99
R9303:Fat1 UTSW 8 45,463,498 (GRCm39) missense probably damaging 1.00
R9319:Fat1 UTSW 8 45,406,060 (GRCm39) missense probably damaging 1.00
R9392:Fat1 UTSW 8 45,476,228 (GRCm39) missense probably damaging 1.00
R9616:Fat1 UTSW 8 45,406,075 (GRCm39) missense probably damaging 0.99
R9712:Fat1 UTSW 8 45,470,417 (GRCm39) missense probably benign 0.05
R9756:Fat1 UTSW 8 45,496,974 (GRCm39) missense probably damaging 0.96
RF001:Fat1 UTSW 8 45,442,003 (GRCm39) missense probably benign 0.00
X0064:Fat1 UTSW 8 45,478,771 (GRCm39) missense possibly damaging 0.58
Z1088:Fat1 UTSW 8 45,476,844 (GRCm39) missense possibly damaging 0.88
Z1176:Fat1 UTSW 8 45,489,875 (GRCm39) missense probably damaging 1.00
Z1176:Fat1 UTSW 8 45,476,633 (GRCm39) missense possibly damaging 0.65
Z1176:Fat1 UTSW 8 45,403,635 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCCACGGCCAGAATGAGATGATG -3'
(R):5'- GTTCACCTAGAGACGGCAGAAACAG -3'

Sequencing Primer
(F):5'- GCCAGAATGAGATGATGTCTTTTCC -3'
(R):5'- GCCGTTTAGATTTCTAAGATGCC -3'
Posted On 2013-05-23