Incidental Mutation 'R5196:Chrm5'
ID400221
Institutional Source Beutler Lab
Gene Symbol Chrm5
Ensembl Gene ENSMUSG00000074939
Gene Namecholinergic receptor, muscarinic 5
SynonymsM5R, muscarinic acetylcholine receptor 5
MMRRC Submission 042772-MU
Accession Numbers

Genbank: NM_205783; MGI: 109248

Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R5196 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location112479171-112480769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112480384 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 129 (Y129C)
Ref Sequence ENSEMBL: ENSMUSP00000097185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099589]
Predicted Effect probably damaging
Transcript: ENSMUST00000099589
AA Change: Y129C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097185
Gene: ENSMUSG00000074939
AA Change: Y129C

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 38 242 2.3e-8 PFAM
Pfam:7TM_GPCR_Srsx 41 253 7.5e-8 PFAM
Pfam:7tm_1 47 495 1.5e-79 PFAM
low complexity region 507 518 N/A INTRINSIC
Meta Mutation Damage Score 0.9595 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The clinical implications of this receptor are unknown; however, stimulation of this receptor is known to increase cyclic AMP levels. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null allele exhibit loss of acetylcholine-induced dilation of cerebral arteries, decreased pilocarpine-induced salivation, increased water-deprivation induced drinking, and attenuated morphine reinforcement and withdrawal. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(3)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,796,438 T281A possibly damaging Het
4930503B20Rik A G 3: 146,646,263 probably benign Het
6330409D20Rik T A 2: 32,740,540 probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Amigo2 A G 15: 97,246,061 F160S probably damaging Het
Arcn1 A T 9: 44,760,027 L68M probably damaging Het
Arhgef25 A G 10: 127,185,109 S303P probably damaging Het
Asph A T 4: 9,607,830 S163T probably damaging Het
BC003331 T A 1: 150,382,389 D165V probably damaging Het
Birc6 T C 17: 74,606,141 probably benign Het
Ccm2 G A 11: 6,561,181 probably benign Het
Cdc42bpa T C 1: 180,072,413 V431A probably benign Het
Cdh7 T A 1: 110,138,000 M668K probably damaging Het
Cfap43 A T 19: 47,825,925 W157R probably damaging Het
Chrna5 A G 9: 55,006,519 I421V possibly damaging Het
Clk1 T A 1: 58,414,613 T301S probably benign Het
Col6a3 G T 1: 90,816,538 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam198a T G 9: 121,965,661 S294A probably benign Het
Fbxw19 T C 9: 109,484,428 Y234C probably benign Het
Fgd4 T A 16: 16,484,142 N183I probably benign Het
Fnip2 T C 3: 79,572,538 probably benign Het
Gm9847 T A 12: 14,495,015 noncoding transcript Het
H2-T23 A G 17: 36,032,607 probably null Het
Hdlbp T C 1: 93,420,193 E613G probably damaging Het
Kat6a G A 8: 22,911,713 R366H probably damaging Het
Kctd4 A G 14: 75,962,687 T33A probably benign Het
Klrb1c T A 6: 128,780,299 S268C probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrfip1 A G 1: 91,114,608 E245G probably damaging Het
Mast3 A T 8: 70,788,245 I220N probably damaging Het
Mfap3 A G 11: 57,529,813 T207A probably damaging Het
Mtdh G T 15: 34,118,004 K75N probably damaging Het
Mybpc1 A G 10: 88,536,351 Y806H probably damaging Het
Ntng1 T C 3: 109,934,983 D158G probably damaging Het
Olfr1176 A G 2: 88,339,748 Y61C possibly damaging Het
Olfr812 T A 10: 129,842,781 D87V possibly damaging Het
Pask A G 1: 93,310,083 probably benign Het
Pif1 G T 9: 65,588,092 A95S probably benign Het
Plppr2 T C 9: 21,941,132 F104S probably damaging Het
Prmt9 G A 8: 77,564,997 V333M probably benign Het
Pten A T 19: 32,815,497 M239L probably benign Het
Rb1cc1 A G 1: 6,234,230 D67G probably damaging Het
Reg2 T A 6: 78,405,547 L12* probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc5a7 C A 17: 54,281,722 probably null Het
Tcaf3 G T 6: 42,593,715 R368S probably benign Het
Tfcp2 A G 15: 100,520,714 V189A probably damaging Het
Uhrf1bp1 A G 17: 27,856,763 I5V probably benign Het
Wdr12 T C 1: 60,087,084 S191G probably damaging Het
Zfp536 G A 7: 37,480,760 R807W probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Chrm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01532:Chrm5 APN 2 112479232 missense probably benign
IGL01611:Chrm5 APN 2 112480306 nonsense probably null
IGL02152:Chrm5 APN 2 112480568 missense probably damaging 1.00
IGL03002:Chrm5 APN 2 112480361 missense probably damaging 1.00
C9142:Chrm5 UTSW 2 112480211 missense probably damaging 1.00
R0200:Chrm5 UTSW 2 112480720 missense probably benign
R0432:Chrm5 UTSW 2 112479655 missense possibly damaging 0.76
R1158:Chrm5 UTSW 2 112479869 missense probably benign 0.00
R1611:Chrm5 UTSW 2 112479187 missense possibly damaging 0.74
R1621:Chrm5 UTSW 2 112479837 missense probably benign 0.00
R1693:Chrm5 UTSW 2 112479280 missense probably damaging 1.00
R1988:Chrm5 UTSW 2 112480252 missense probably damaging 0.99
R1989:Chrm5 UTSW 2 112480252 missense probably damaging 0.99
R2071:Chrm5 UTSW 2 112479227 missense probably null 0.93
R2890:Chrm5 UTSW 2 112479703 missense probably benign 0.00
R4659:Chrm5 UTSW 2 112479757 missense probably benign
R4785:Chrm5 UTSW 2 112479585 missense probably benign 0.25
R5734:Chrm5 UTSW 2 112480100 missense probably benign 0.28
R6343:Chrm5 UTSW 2 112479448 missense probably damaging 1.00
R6499:Chrm5 UTSW 2 112480480 missense probably benign
R6672:Chrm5 UTSW 2 112479796 missense probably benign
R6905:Chrm5 UTSW 2 112479556 missense probably benign 0.00
R7192:Chrm5 UTSW 2 112480327 missense probably damaging 0.97
R7775:Chrm5 UTSW 2 112479956 missense probably benign 0.07
R7778:Chrm5 UTSW 2 112479956 missense probably benign 0.07
X0023:Chrm5 UTSW 2 112480481 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGGTCCCAAAAGTGATGGTG -3'
(R):5'- AACAACTATTACCTGCTCAGCTTG -3'

Sequencing Primer
(F):5'- TCCCAAAAGTGATGGTGGGCTC -3'
(R):5'- TGGCCTGTGCAGACCTCATC -3'
Posted On2016-07-06