Incidental Mutation 'R5196:Ntng1'
ID400225
Institutional Source Beutler Lab
Gene Symbol Ntng1
Ensembl Gene ENSMUSG00000059857
Gene Namenetrin G1
SynonymsLmnt1, A930010C08Rik
MMRRC Submission 042772-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5196 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location109780040-110144011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109934983 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 158 (D158G)
Ref Sequence ENSEMBL: ENSMUSP00000102180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072596] [ENSMUST00000106570] [ENSMUST00000106571] [ENSMUST00000106575] [ENSMUST00000128219] [ENSMUST00000131027] [ENSMUST00000133268] [ENSMUST00000138344] [ENSMUST00000138953] [ENSMUST00000156177]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072596
AA Change: D158G

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072397
Gene: ENSMUSG00000059857
AA Change: D158G

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF_Lam 364 417 4.81e-8 SMART
EGF_Lam 420 462 5.74e-6 SMART
EGF 466 498 5.12e-3 SMART
low complexity region 522 537 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106570
AA Change: D158G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102180
Gene: ENSMUSG00000059857
AA Change: D158G

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 355 1.28e-3 SMART
EGF 388 420 5.12e-3 SMART
low complexity region 444 459 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106571
AA Change: D158G

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102181
Gene: ENSMUSG00000059857
AA Change: D158G

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF 408 440 5.12e-3 SMART
low complexity region 464 479 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106575
AA Change: D158G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102185
Gene: ENSMUSG00000059857
AA Change: D158G

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 355 3.33e-2 SMART
EGF_Lam 364 417 4.81e-8 SMART
EGF_Lam 420 462 5.74e-6 SMART
EGF 466 498 5.12e-3 SMART
low complexity region 522 537 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000128219
AA Change: D158G

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116579
Gene: ENSMUSG00000059857
AA Change: D158G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LamNT 59 295 1.5e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000131027
AA Change: D158G

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118800
Gene: ENSMUSG00000059857
AA Change: D158G

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF_Lam 364 417 4.81e-8 SMART
EGF 421 453 5.12e-3 SMART
low complexity region 477 492 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000133268
AA Change: D158G

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117371
Gene: ENSMUSG00000059857
AA Change: D158G

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF 365 397 5.12e-3 SMART
low complexity region 421 436 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000138344
AA Change: D158G

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120688
Gene: ENSMUSG00000059857
AA Change: D158G

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF_Lam 364 406 5.74e-6 SMART
EGF 410 442 5.12e-3 SMART
low complexity region 466 481 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000138953
AA Change: D158G

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116213
Gene: ENSMUSG00000059857
AA Change: D158G

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF 407 439 5.12e-3 SMART
low complexity region 463 478 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000156177
AA Change: D158G

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119534
Gene: ENSMUSG00000059857
AA Change: D158G

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF 387 419 5.12e-3 SMART
low complexity region 443 458 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189335
Meta Mutation Damage Score 0.0704 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a preproprotein that is processed into a secreted protein containing eukaroytic growth factor (EGF)-like domains. This protein acts to guide axon growth during neuronal development. Polymorphisms in this gene may be associated with schizophrenia. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele survive into adulthood with no major alterations in gross brain cytoarchitecture or axonal projection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,796,438 T281A possibly damaging Het
4930503B20Rik A G 3: 146,646,263 probably benign Het
6330409D20Rik T A 2: 32,740,540 probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Amigo2 A G 15: 97,246,061 F160S probably damaging Het
Arcn1 A T 9: 44,760,027 L68M probably damaging Het
Arhgef25 A G 10: 127,185,109 S303P probably damaging Het
Asph A T 4: 9,607,830 S163T probably damaging Het
BC003331 T A 1: 150,382,389 D165V probably damaging Het
Birc6 T C 17: 74,606,141 probably benign Het
Ccm2 G A 11: 6,561,181 probably benign Het
Cdc42bpa T C 1: 180,072,413 V431A probably benign Het
Cdh7 T A 1: 110,138,000 M668K probably damaging Het
Cfap43 A T 19: 47,825,925 W157R probably damaging Het
Chrm5 T C 2: 112,480,384 Y129C probably damaging Het
Chrna5 A G 9: 55,006,519 I421V possibly damaging Het
Clk1 T A 1: 58,414,613 T301S probably benign Het
Col6a3 G T 1: 90,816,538 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam198a T G 9: 121,965,661 S294A probably benign Het
Fbxw19 T C 9: 109,484,428 Y234C probably benign Het
Fgd4 T A 16: 16,484,142 N183I probably benign Het
Fnip2 T C 3: 79,572,538 probably benign Het
Gm9847 T A 12: 14,495,015 noncoding transcript Het
H2-T23 A G 17: 36,032,607 probably null Het
Hdlbp T C 1: 93,420,193 E613G probably damaging Het
Kat6a G A 8: 22,911,713 R366H probably damaging Het
Kctd4 A G 14: 75,962,687 T33A probably benign Het
Klrb1c T A 6: 128,780,299 S268C probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrfip1 A G 1: 91,114,608 E245G probably damaging Het
Mast3 A T 8: 70,788,245 I220N probably damaging Het
Mfap3 A G 11: 57,529,813 T207A probably damaging Het
Mtdh G T 15: 34,118,004 K75N probably damaging Het
Mybpc1 A G 10: 88,536,351 Y806H probably damaging Het
Olfr1176 A G 2: 88,339,748 Y61C possibly damaging Het
Olfr812 T A 10: 129,842,781 D87V possibly damaging Het
Pask A G 1: 93,310,083 probably benign Het
Pif1 G T 9: 65,588,092 A95S probably benign Het
Plppr2 T C 9: 21,941,132 F104S probably damaging Het
Prmt9 G A 8: 77,564,997 V333M probably benign Het
Pten A T 19: 32,815,497 M239L probably benign Het
Rb1cc1 A G 1: 6,234,230 D67G probably damaging Het
Reg2 T A 6: 78,405,547 L12* probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc5a7 C A 17: 54,281,722 probably null Het
Tcaf3 G T 6: 42,593,715 R368S probably benign Het
Tfcp2 A G 15: 100,520,714 V189A probably damaging Het
Uhrf1bp1 A G 17: 27,856,763 I5V probably benign Het
Wdr12 T C 1: 60,087,084 S191G probably damaging Het
Zfp536 G A 7: 37,480,760 R807W probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Ntng1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02162:Ntng1 APN 3 109934995 nonsense probably null
IGL02367:Ntng1 APN 3 110135513 unclassified probably null
IGL02448:Ntng1 APN 3 109934559 splice site probably benign
IGL02487:Ntng1 APN 3 109935047 missense probably damaging 0.98
IGL02500:Ntng1 APN 3 110135330 missense probably damaging 1.00
IGL02578:Ntng1 APN 3 110135394 missense probably benign 0.01
IGL03009:Ntng1 APN 3 109934702 missense possibly damaging 0.89
IGL03096:Ntng1 APN 3 110135349 missense probably benign 0.19
R0108:Ntng1 UTSW 3 109851755 splice site probably benign
R0326:Ntng1 UTSW 3 110135503 nonsense probably null
R0403:Ntng1 UTSW 3 109934611 missense probably damaging 0.97
R0699:Ntng1 UTSW 3 109872295 missense probably damaging 1.00
R0702:Ntng1 UTSW 3 109872254 missense probably damaging 1.00
R1981:Ntng1 UTSW 3 109935010 missense possibly damaging 0.61
R2096:Ntng1 UTSW 3 109832555 missense probably damaging 0.99
R3739:Ntng1 UTSW 3 109934691 missense probably damaging 1.00
R3963:Ntng1 UTSW 3 109934868 missense probably damaging 1.00
R4484:Ntng1 UTSW 3 110143808 unclassified probably benign
R4516:Ntng1 UTSW 3 109935013 missense probably damaging 1.00
R4518:Ntng1 UTSW 3 109935013 missense probably damaging 1.00
R4520:Ntng1 UTSW 3 109934996 missense probably damaging 1.00
R4523:Ntng1 UTSW 3 109934996 missense probably damaging 1.00
R4524:Ntng1 UTSW 3 109934996 missense probably damaging 1.00
R4776:Ntng1 UTSW 3 109934713 missense probably damaging 1.00
R4817:Ntng1 UTSW 3 109934868 missense probably damaging 1.00
R4827:Ntng1 UTSW 3 110135411 missense probably damaging 1.00
R4990:Ntng1 UTSW 3 110135261 critical splice donor site probably null
R5067:Ntng1 UTSW 3 110135345 missense possibly damaging 0.95
R5087:Ntng1 UTSW 3 110135329 nonsense probably null
R5263:Ntng1 UTSW 3 109934872 missense probably damaging 0.99
R5743:Ntng1 UTSW 3 110135420 missense probably damaging 1.00
R6268:Ntng1 UTSW 3 109935035 missense probably damaging 1.00
R6292:Ntng1 UTSW 3 110143886 unclassified probably benign
R6419:Ntng1 UTSW 3 109782853 missense possibly damaging 0.95
R6898:Ntng1 UTSW 3 109872218 missense probably damaging 0.98
R7081:Ntng1 UTSW 3 109851789 missense probably benign 0.00
R7090:Ntng1 UTSW 3 109935180 nonsense probably null
R7134:Ntng1 UTSW 3 109935129 missense probably benign
R7302:Ntng1 UTSW 3 109832617 missense possibly damaging 0.94
R7353:Ntng1 UTSW 3 110135447 missense probably damaging 1.00
R7408:Ntng1 UTSW 3 109853082 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTGTCTTTGATCTCGAAGTGG -3'
(R):5'- ATGCGAGTACCCCTGAACTG -3'

Sequencing Primer
(F):5'- TTGCTATTCGTGGAGTACCC -3'
(R):5'- TGAACTGGCACACCCTCCTG -3'
Posted On2016-07-06