Incidental Mutation 'R5196:Tcaf3'
ID400235
Institutional Source Beutler Lab
Gene Symbol Tcaf3
Ensembl Gene ENSMUSG00000018656
Gene NameTRPM8 channel-associated factor 3
SynonymsEapa2, Fam115e
MMRRC Submission 042772-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5196 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location42584866-42597692 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 42593715 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 368 (R368S)
Ref Sequence ENSEMBL: ENSMUSP00000064060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000134707]
Predicted Effect probably benign
Transcript: ENSMUST00000069023
AA Change: R368S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: R368S

DomainStartEndE-ValueType
internal_repeat_1 26 194 9.98e-16 PROSPERO
low complexity region 210 221 N/A INTRINSIC
internal_repeat_1 234 402 9.98e-16 PROSPERO
low complexity region 509 518 N/A INTRINSIC
M60-like 533 832 3.49e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134707
SMART Domains Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656

DomainStartEndE-ValueType
low complexity region 210 221 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,796,438 T281A possibly damaging Het
4930503B20Rik A G 3: 146,646,263 probably benign Het
6330409D20Rik T A 2: 32,740,540 probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Amigo2 A G 15: 97,246,061 F160S probably damaging Het
Arcn1 A T 9: 44,760,027 L68M probably damaging Het
Arhgef25 A G 10: 127,185,109 S303P probably damaging Het
Asph A T 4: 9,607,830 S163T probably damaging Het
BC003331 T A 1: 150,382,389 D165V probably damaging Het
Birc6 T C 17: 74,606,141 probably benign Het
Ccm2 G A 11: 6,561,181 probably benign Het
Cdc42bpa T C 1: 180,072,413 V431A probably benign Het
Cdh7 T A 1: 110,138,000 M668K probably damaging Het
Cfap43 A T 19: 47,825,925 W157R probably damaging Het
Chrm5 T C 2: 112,480,384 Y129C probably damaging Het
Chrna5 A G 9: 55,006,519 I421V possibly damaging Het
Clk1 T A 1: 58,414,613 T301S probably benign Het
Col6a3 G T 1: 90,816,538 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam198a T G 9: 121,965,661 S294A probably benign Het
Fbxw19 T C 9: 109,484,428 Y234C probably benign Het
Fgd4 T A 16: 16,484,142 N183I probably benign Het
Fnip2 T C 3: 79,572,538 probably benign Het
Gm9847 T A 12: 14,495,015 noncoding transcript Het
H2-T23 A G 17: 36,032,607 probably null Het
Hdlbp T C 1: 93,420,193 E613G probably damaging Het
Kat6a G A 8: 22,911,713 R366H probably damaging Het
Kctd4 A G 14: 75,962,687 T33A probably benign Het
Klrb1c T A 6: 128,780,299 S268C probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrfip1 A G 1: 91,114,608 E245G probably damaging Het
Mast3 A T 8: 70,788,245 I220N probably damaging Het
Mfap3 A G 11: 57,529,813 T207A probably damaging Het
Mtdh G T 15: 34,118,004 K75N probably damaging Het
Mybpc1 A G 10: 88,536,351 Y806H probably damaging Het
Ntng1 T C 3: 109,934,983 D158G probably damaging Het
Olfr1176 A G 2: 88,339,748 Y61C possibly damaging Het
Olfr812 T A 10: 129,842,781 D87V possibly damaging Het
Pask A G 1: 93,310,083 probably benign Het
Pif1 G T 9: 65,588,092 A95S probably benign Het
Plppr2 T C 9: 21,941,132 F104S probably damaging Het
Prmt9 G A 8: 77,564,997 V333M probably benign Het
Pten A T 19: 32,815,497 M239L probably benign Het
Rb1cc1 A G 1: 6,234,230 D67G probably damaging Het
Reg2 T A 6: 78,405,547 L12* probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc5a7 C A 17: 54,281,722 probably null Het
Tfcp2 A G 15: 100,520,714 V189A probably damaging Het
Uhrf1bp1 A G 17: 27,856,763 I5V probably benign Het
Wdr12 T C 1: 60,087,084 S191G probably damaging Het
Zfp536 G A 7: 37,480,760 R807W probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Tcaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tcaf3 APN 6 42593385 missense probably benign 0.14
IGL00931:Tcaf3 APN 6 42597228 missense probably benign 0.16
IGL01391:Tcaf3 APN 6 42593681 missense probably damaging 1.00
IGL01804:Tcaf3 APN 6 42597129 missense probably damaging 1.00
IGL02272:Tcaf3 APN 6 42596660 missense probably damaging 0.98
IGL02934:Tcaf3 APN 6 42593898 missense probably benign 0.00
IGL03258:Tcaf3 APN 6 42589839 missense probably damaging 1.00
defused UTSW 6 42596933 missense probably benign 0.03
R0116:Tcaf3 UTSW 6 42591350 missense probably benign 0.12
R0135:Tcaf3 UTSW 6 42589758 missense probably benign
R0357:Tcaf3 UTSW 6 42589827 missense probably damaging 0.98
R0526:Tcaf3 UTSW 6 42589804 missense probably damaging 1.00
R0592:Tcaf3 UTSW 6 42596843 missense probably benign 0.16
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1902:Tcaf3 UTSW 6 42593552 missense possibly damaging 0.83
R1912:Tcaf3 UTSW 6 42596688 missense possibly damaging 0.59
R2020:Tcaf3 UTSW 6 42593724 missense possibly damaging 0.66
R2238:Tcaf3 UTSW 6 42593328 missense probably benign 0.00
R2259:Tcaf3 UTSW 6 42591430 missense possibly damaging 0.53
R2436:Tcaf3 UTSW 6 42593729 missense probably damaging 1.00
R3005:Tcaf3 UTSW 6 42594044 missense probably damaging 1.00
R3402:Tcaf3 UTSW 6 42593853 missense probably benign 0.08
R3753:Tcaf3 UTSW 6 42589804 missense probably damaging 1.00
R3799:Tcaf3 UTSW 6 42597080 missense probably damaging 1.00
R4515:Tcaf3 UTSW 6 42589996 missense probably damaging 1.00
R4640:Tcaf3 UTSW 6 42587579 missense probably damaging 0.96
R4688:Tcaf3 UTSW 6 42593366 unclassified probably null
R4904:Tcaf3 UTSW 6 42593997 nonsense probably null
R5030:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5031:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5045:Tcaf3 UTSW 6 42593684 missense possibly damaging 0.55
R5105:Tcaf3 UTSW 6 42591325 missense probably damaging 1.00
R5139:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5187:Tcaf3 UTSW 6 42597020 missense possibly damaging 0.51
R5213:Tcaf3 UTSW 6 42591467 missense probably damaging 1.00
R5296:Tcaf3 UTSW 6 42587510 missense possibly damaging 0.55
R5402:Tcaf3 UTSW 6 42591926 missense probably benign 0.12
R5425:Tcaf3 UTSW 6 42596763 missense probably damaging 1.00
R5431:Tcaf3 UTSW 6 42597185 missense probably damaging 1.00
R5601:Tcaf3 UTSW 6 42587528 missense possibly damaging 0.90
R5839:Tcaf3 UTSW 6 42593849 missense possibly damaging 0.55
R5865:Tcaf3 UTSW 6 42596697 missense probably benign 0.07
R6005:Tcaf3 UTSW 6 42589971 missense probably benign 0.19
R6270:Tcaf3 UTSW 6 42593791 missense probably benign 0.00
R6341:Tcaf3 UTSW 6 42597259 missense possibly damaging 0.55
R6344:Tcaf3 UTSW 6 42597171 missense possibly damaging 0.48
R6521:Tcaf3 UTSW 6 42593238 missense probably damaging 0.99
R6589:Tcaf3 UTSW 6 42594061 missense possibly damaging 0.55
R6981:Tcaf3 UTSW 6 42597125 missense probably damaging 1.00
R7155:Tcaf3 UTSW 6 42593891 missense probably benign
R7185:Tcaf3 UTSW 6 42593930 missense probably benign 0.01
R7262:Tcaf3 UTSW 6 42593801 missense probably damaging 0.97
R7340:Tcaf3 UTSW 6 42589914 missense probably benign 0.08
R7421:Tcaf3 UTSW 6 42596842 missense probably benign 0.02
R7690:Tcaf3 UTSW 6 42597135 missense probably damaging 1.00
R7850:Tcaf3 UTSW 6 42594206 splice site probably null
R7909:Tcaf3 UTSW 6 42591964 missense possibly damaging 0.92
R7933:Tcaf3 UTSW 6 42594206 splice site probably null
R7990:Tcaf3 UTSW 6 42591964 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCTCTCGTGTAAGCTACTCC -3'
(R):5'- GGCAGAATTGGGTTAGCTTCAG -3'

Sequencing Primer
(F):5'- TAAGCTACTCCCCCGGCTGTAG -3'
(R):5'- CAGAATTGGGTTAGCTTCAGATATG -3'
Posted On2016-07-06