Incidental Mutation 'R5196:Tcaf3'
ID 400235
Institutional Source Beutler Lab
Gene Symbol Tcaf3
Ensembl Gene ENSMUSG00000018656
Gene Name TRPM8 channel-associated factor 3
Synonyms Eapa2, Fam115e
MMRRC Submission 042772-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R5196 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 42564147-42574306 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 42570649 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 368 (R368S)
Ref Sequence ENSEMBL: ENSMUSP00000064060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000134707]
AlphaFold Q6QR59
Predicted Effect probably benign
Transcript: ENSMUST00000069023
AA Change: R368S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: R368S

DomainStartEndE-ValueType
internal_repeat_1 26 194 9.98e-16 PROSPERO
low complexity region 210 221 N/A INTRINSIC
internal_repeat_1 234 402 9.98e-16 PROSPERO
low complexity region 509 518 N/A INTRINSIC
M60-like 533 832 3.49e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134707
SMART Domains Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656

DomainStartEndE-ValueType
low complexity region 210 221 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,686,450 (GRCm39) T281A possibly damaging Het
4930503B20Rik A G 3: 146,352,018 (GRCm39) probably benign Het
6330409D20Rik T A 2: 32,630,552 (GRCm39) probably benign Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Amigo2 A G 15: 97,143,942 (GRCm39) F160S probably damaging Het
Arcn1 A T 9: 44,671,324 (GRCm39) L68M probably damaging Het
Arhgef25 A G 10: 127,020,978 (GRCm39) S303P probably damaging Het
Asph A T 4: 9,607,830 (GRCm39) S163T probably damaging Het
Birc6 T C 17: 74,913,136 (GRCm39) probably benign Het
Bltp3a A G 17: 28,075,737 (GRCm39) I5V probably benign Het
Ccm2 G A 11: 6,511,181 (GRCm39) probably benign Het
Cdc42bpa T C 1: 179,899,978 (GRCm39) V431A probably benign Het
Cdh20 T A 1: 110,065,730 (GRCm39) M668K probably damaging Het
Cfap43 A T 19: 47,814,364 (GRCm39) W157R probably damaging Het
Chrm5 T C 2: 112,310,729 (GRCm39) Y129C probably damaging Het
Chrna5 A G 9: 54,913,803 (GRCm39) I421V possibly damaging Het
Clk1 T A 1: 58,453,772 (GRCm39) T301S probably benign Het
Col6a3 G T 1: 90,744,260 (GRCm39) probably null Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Fbxw19 T C 9: 109,313,496 (GRCm39) Y234C probably benign Het
Fgd4 T A 16: 16,302,006 (GRCm39) N183I probably benign Het
Fnip2 T C 3: 79,479,845 (GRCm39) probably benign Het
Gask1a T G 9: 121,794,727 (GRCm39) S294A probably benign Het
Gm9847 T A 12: 14,545,016 (GRCm39) noncoding transcript Het
H2-T23 A G 17: 36,343,499 (GRCm39) probably null Het
Hdlbp T C 1: 93,347,915 (GRCm39) E613G probably damaging Het
Kat6a G A 8: 23,401,729 (GRCm39) R366H probably damaging Het
Kctd4 A G 14: 76,200,127 (GRCm39) T33A probably benign Het
Klrb1c T A 6: 128,757,262 (GRCm39) S268C probably benign Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Lrrfip1 A G 1: 91,042,330 (GRCm39) E245G probably damaging Het
Mast3 A T 8: 71,240,889 (GRCm39) I220N probably damaging Het
Mfap3 A G 11: 57,420,639 (GRCm39) T207A probably damaging Het
Mtdh G T 15: 34,118,150 (GRCm39) K75N probably damaging Het
Mybpc1 A G 10: 88,372,213 (GRCm39) Y806H probably damaging Het
Ntng1 T C 3: 109,842,299 (GRCm39) D158G probably damaging Het
Odr4 T A 1: 150,258,140 (GRCm39) D165V probably damaging Het
Or5d46 A G 2: 88,170,092 (GRCm39) Y61C possibly damaging Het
Or6c216 T A 10: 129,678,650 (GRCm39) D87V possibly damaging Het
Pask A G 1: 93,237,805 (GRCm39) probably benign Het
Pif1 G T 9: 65,495,374 (GRCm39) A95S probably benign Het
Plppr2 T C 9: 21,852,428 (GRCm39) F104S probably damaging Het
Prmt9 G A 8: 78,291,626 (GRCm39) V333M probably benign Het
Pten A T 19: 32,792,897 (GRCm39) M239L probably benign Het
Rb1cc1 A G 1: 6,304,454 (GRCm39) D67G probably damaging Het
Reg2 T A 6: 78,382,530 (GRCm39) L12* probably null Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Slc5a7 C A 17: 54,588,750 (GRCm39) probably null Het
Tfcp2 A G 15: 100,418,595 (GRCm39) V189A probably damaging Het
Wdr12 T C 1: 60,126,243 (GRCm39) S191G probably damaging Het
Zfp536 G A 7: 37,180,185 (GRCm39) R807W probably damaging Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Other mutations in Tcaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tcaf3 APN 6 42,570,319 (GRCm39) missense probably benign 0.14
IGL00931:Tcaf3 APN 6 42,574,162 (GRCm39) missense probably benign 0.16
IGL01391:Tcaf3 APN 6 42,570,615 (GRCm39) missense probably damaging 1.00
IGL01804:Tcaf3 APN 6 42,574,063 (GRCm39) missense probably damaging 1.00
IGL02272:Tcaf3 APN 6 42,573,594 (GRCm39) missense probably damaging 0.98
IGL02934:Tcaf3 APN 6 42,570,832 (GRCm39) missense probably benign 0.00
IGL03258:Tcaf3 APN 6 42,566,773 (GRCm39) missense probably damaging 1.00
defused UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R0116:Tcaf3 UTSW 6 42,568,284 (GRCm39) missense probably benign 0.12
R0135:Tcaf3 UTSW 6 42,566,692 (GRCm39) missense probably benign
R0357:Tcaf3 UTSW 6 42,566,761 (GRCm39) missense probably damaging 0.98
R0526:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R0592:Tcaf3 UTSW 6 42,573,777 (GRCm39) missense probably benign 0.16
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1902:Tcaf3 UTSW 6 42,570,486 (GRCm39) missense possibly damaging 0.83
R1912:Tcaf3 UTSW 6 42,573,622 (GRCm39) missense possibly damaging 0.59
R2020:Tcaf3 UTSW 6 42,570,658 (GRCm39) missense possibly damaging 0.66
R2238:Tcaf3 UTSW 6 42,570,262 (GRCm39) missense probably benign 0.00
R2259:Tcaf3 UTSW 6 42,568,364 (GRCm39) missense possibly damaging 0.53
R2436:Tcaf3 UTSW 6 42,570,663 (GRCm39) missense probably damaging 1.00
R3005:Tcaf3 UTSW 6 42,570,978 (GRCm39) missense probably damaging 1.00
R3402:Tcaf3 UTSW 6 42,570,787 (GRCm39) missense probably benign 0.08
R3753:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R3799:Tcaf3 UTSW 6 42,574,014 (GRCm39) missense probably damaging 1.00
R4515:Tcaf3 UTSW 6 42,566,930 (GRCm39) missense probably damaging 1.00
R4640:Tcaf3 UTSW 6 42,564,513 (GRCm39) missense probably damaging 0.96
R4688:Tcaf3 UTSW 6 42,570,300 (GRCm39) splice site probably null
R4904:Tcaf3 UTSW 6 42,570,931 (GRCm39) nonsense probably null
R5030:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5031:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5045:Tcaf3 UTSW 6 42,570,618 (GRCm39) missense possibly damaging 0.55
R5105:Tcaf3 UTSW 6 42,568,259 (GRCm39) missense probably damaging 1.00
R5139:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5187:Tcaf3 UTSW 6 42,573,954 (GRCm39) missense possibly damaging 0.51
R5213:Tcaf3 UTSW 6 42,568,401 (GRCm39) missense probably damaging 1.00
R5296:Tcaf3 UTSW 6 42,564,444 (GRCm39) missense possibly damaging 0.55
R5402:Tcaf3 UTSW 6 42,568,860 (GRCm39) missense probably benign 0.12
R5425:Tcaf3 UTSW 6 42,573,697 (GRCm39) missense probably damaging 1.00
R5431:Tcaf3 UTSW 6 42,574,119 (GRCm39) missense probably damaging 1.00
R5601:Tcaf3 UTSW 6 42,564,462 (GRCm39) missense possibly damaging 0.90
R5839:Tcaf3 UTSW 6 42,570,783 (GRCm39) missense possibly damaging 0.55
R5865:Tcaf3 UTSW 6 42,573,631 (GRCm39) missense probably benign 0.07
R6005:Tcaf3 UTSW 6 42,566,905 (GRCm39) missense probably benign 0.19
R6270:Tcaf3 UTSW 6 42,570,725 (GRCm39) missense probably benign 0.00
R6341:Tcaf3 UTSW 6 42,574,193 (GRCm39) missense possibly damaging 0.55
R6344:Tcaf3 UTSW 6 42,574,105 (GRCm39) missense possibly damaging 0.48
R6521:Tcaf3 UTSW 6 42,570,172 (GRCm39) missense probably damaging 0.99
R6589:Tcaf3 UTSW 6 42,570,995 (GRCm39) missense possibly damaging 0.55
R6981:Tcaf3 UTSW 6 42,574,059 (GRCm39) missense probably damaging 1.00
R7155:Tcaf3 UTSW 6 42,570,825 (GRCm39) missense probably benign
R7185:Tcaf3 UTSW 6 42,570,864 (GRCm39) missense probably benign 0.01
R7262:Tcaf3 UTSW 6 42,570,735 (GRCm39) missense probably damaging 0.97
R7340:Tcaf3 UTSW 6 42,566,848 (GRCm39) missense probably benign 0.08
R7421:Tcaf3 UTSW 6 42,573,776 (GRCm39) missense probably benign 0.02
R7690:Tcaf3 UTSW 6 42,574,069 (GRCm39) missense probably damaging 1.00
R7850:Tcaf3 UTSW 6 42,571,140 (GRCm39) splice site probably null
R7909:Tcaf3 UTSW 6 42,568,898 (GRCm39) missense possibly damaging 0.92
R9419:Tcaf3 UTSW 6 42,573,716 (GRCm39) missense probably benign 0.00
R9440:Tcaf3 UTSW 6 42,573,906 (GRCm39) nonsense probably null
R9469:Tcaf3 UTSW 6 42,573,828 (GRCm39) missense probably benign 0.00
R9668:Tcaf3 UTSW 6 42,566,636 (GRCm39) missense probably damaging 1.00
R9787:Tcaf3 UTSW 6 42,574,024 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTCTCGTGTAAGCTACTCC -3'
(R):5'- GGCAGAATTGGGTTAGCTTCAG -3'

Sequencing Primer
(F):5'- TAAGCTACTCCCCCGGCTGTAG -3'
(R):5'- CAGAATTGGGTTAGCTTCAGATATG -3'
Posted On 2016-07-06