Incidental Mutation 'R5196:Reg2'
ID400236
Institutional Source Beutler Lab
Gene Symbol Reg2
Ensembl Gene ENSMUSG00000023140
Gene Nameregenerating islet-derived 2
Synonymspancreatic thread protein
MMRRC Submission 042772-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5196 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location78395623-78408106 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 78405547 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 12 (L12*)
Ref Sequence ENSEMBL: ENSMUSP00000145184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023906] [ENSMUST00000203657]
Predicted Effect probably null
Transcript: ENSMUST00000023906
AA Change: L12*
SMART Domains Protein: ENSMUSP00000023906
Gene: ENSMUSG00000023140
AA Change: L12*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CLECT 43 170 1.15e-33 SMART
Predicted Effect probably null
Transcript: ENSMUST00000203657
AA Change: L12*
SMART Domains Protein: ENSMUSP00000145184
Gene: ENSMUSG00000023140
AA Change: L12*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CLECT 43 132 1.4e-9 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a type I subclass member of the Reg gene family. The Reg gene family is a multigene family grouped into four subclasses, types I, II, III and IV based on the primary structures of the encoded proteins. This gene encodes a protein secreted by the exocrine pancreas that is highly similar to the REG1A protein. The related REG1A protein is associated with islet cell regeneration and diabetogenesis, and may be involved in pancreatic lithogenesis. Reg family members REG1A, REGL, PAP and this gene are tandemly clustered on chromosome 2p12 and may have arisen from the same ancestral gene by gene duplication. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired suckling, delayed hypoglossal myelination and reduced liver regeneration following partial hepatectomy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,796,438 T281A possibly damaging Het
4930503B20Rik A G 3: 146,646,263 probably benign Het
6330409D20Rik T A 2: 32,740,540 probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Amigo2 A G 15: 97,246,061 F160S probably damaging Het
Arcn1 A T 9: 44,760,027 L68M probably damaging Het
Arhgef25 A G 10: 127,185,109 S303P probably damaging Het
Asph A T 4: 9,607,830 S163T probably damaging Het
BC003331 T A 1: 150,382,389 D165V probably damaging Het
Birc6 T C 17: 74,606,141 probably benign Het
Ccm2 G A 11: 6,561,181 probably benign Het
Cdc42bpa T C 1: 180,072,413 V431A probably benign Het
Cdh7 T A 1: 110,138,000 M668K probably damaging Het
Cfap43 A T 19: 47,825,925 W157R probably damaging Het
Chrm5 T C 2: 112,480,384 Y129C probably damaging Het
Chrna5 A G 9: 55,006,519 I421V possibly damaging Het
Clk1 T A 1: 58,414,613 T301S probably benign Het
Col6a3 G T 1: 90,816,538 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam198a T G 9: 121,965,661 S294A probably benign Het
Fbxw19 T C 9: 109,484,428 Y234C probably benign Het
Fgd4 T A 16: 16,484,142 N183I probably benign Het
Fnip2 T C 3: 79,572,538 probably benign Het
Gm9847 T A 12: 14,495,015 noncoding transcript Het
H2-T23 A G 17: 36,032,607 probably null Het
Hdlbp T C 1: 93,420,193 E613G probably damaging Het
Kat6a G A 8: 22,911,713 R366H probably damaging Het
Kctd4 A G 14: 75,962,687 T33A probably benign Het
Klrb1c T A 6: 128,780,299 S268C probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrfip1 A G 1: 91,114,608 E245G probably damaging Het
Mast3 A T 8: 70,788,245 I220N probably damaging Het
Mfap3 A G 11: 57,529,813 T207A probably damaging Het
Mtdh G T 15: 34,118,004 K75N probably damaging Het
Mybpc1 A G 10: 88,536,351 Y806H probably damaging Het
Ntng1 T C 3: 109,934,983 D158G probably damaging Het
Olfr1176 A G 2: 88,339,748 Y61C possibly damaging Het
Olfr812 T A 10: 129,842,781 D87V possibly damaging Het
Pask A G 1: 93,310,083 probably benign Het
Pif1 G T 9: 65,588,092 A95S probably benign Het
Plppr2 T C 9: 21,941,132 F104S probably damaging Het
Prmt9 G A 8: 77,564,997 V333M probably benign Het
Pten A T 19: 32,815,497 M239L probably benign Het
Rb1cc1 A G 1: 6,234,230 D67G probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc5a7 C A 17: 54,281,722 probably null Het
Tcaf3 G T 6: 42,593,715 R368S probably benign Het
Tfcp2 A G 15: 100,520,714 V189A probably damaging Het
Uhrf1bp1 A G 17: 27,856,763 I5V probably benign Het
Wdr12 T C 1: 60,087,084 S191G probably damaging Het
Zfp536 G A 7: 37,480,760 R807W probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Reg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Reg2 APN 6 78406221 nonsense probably null
IGL02146:Reg2 APN 6 78405585 splice site probably benign
IGL02236:Reg2 APN 6 78406205 missense probably damaging 1.00
IGL02933:Reg2 APN 6 78407934 missense probably damaging 1.00
R0309:Reg2 UTSW 6 78406186 missense possibly damaging 0.90
R4171:Reg2 UTSW 6 78406591 missense probably damaging 1.00
R6013:Reg2 UTSW 6 78407969 missense possibly damaging 0.94
R6830:Reg2 UTSW 6 78407642 missense possibly damaging 0.94
R7324:Reg2 UTSW 6 78406154 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- ACCAGTGGAGGCCCAAATTG -3'
(R):5'- GAAGGTCTGTGATCATTGAAGC -3'

Sequencing Primer
(F):5'- GGATACAAGGGAGCCTTCTCAC -3'
(R):5'- GCAATAAGAATACTGGTTGCCCTC -3'
Posted On2016-07-06