Incidental Mutation 'R5196:Eml2'
ID 400240
Institutional Source Beutler Lab
Gene Symbol Eml2
Ensembl Gene ENSMUSG00000040811
Gene Name echinoderm microtubule associated protein like 2
Synonyms 1600029N02Rik
MMRRC Submission 042772-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5196 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 18910346-18940407 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 18935088 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 432 (V432I)
Ref Sequence ENSEMBL: ENSMUSP00000112447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048502] [ENSMUST00000117338] [ENSMUST00000120595] [ENSMUST00000148246]
AlphaFold Q7TNG5
Predicted Effect probably damaging
Transcript: ENSMUST00000048502
AA Change: V451I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037654
Gene: ENSMUSG00000040811
AA Change: V451I

DomainStartEndE-ValueType
Pfam:HELP 17 65 4.6e-14 PFAM
WD40 113 162 8.36e-2 SMART
WD40 165 210 9.21e0 SMART
WD40 213 252 7.99e-1 SMART
WD40 258 298 3.7e0 SMART
WD40 301 341 3.58e-1 SMART
WD40 385 424 5.52e-2 SMART
WD40 427 465 1.1e1 SMART
WD40 468 507 4.95e-4 SMART
WD40 514 553 4.62e-4 SMART
WD40 579 620 4.75e1 SMART
WD40 626 666 2.67e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117338
AA Change: V624I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112491
Gene: ENSMUSG00000040811
AA Change: V624I

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
coiled coil region 59 106 N/A INTRINSIC
low complexity region 183 191 N/A INTRINSIC
Pfam:HELP 211 285 3.5e-29 PFAM
WD40 286 335 5.5e-4 SMART
WD40 338 383 5.8e-2 SMART
WD40 386 425 5.2e-3 SMART
WD40 431 471 2.4e-2 SMART
WD40 474 514 2.3e-3 SMART
WD40 558 597 3.6e-4 SMART
WD40 600 638 7.1e-2 SMART
WD40 641 680 3.1e-6 SMART
WD40 687 726 3.1e-6 SMART
WD40 752 793 3e-1 SMART
WD40 799 839 1.7e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120595
AA Change: V432I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112447
Gene: ENSMUSG00000040811
AA Change: V432I

DomainStartEndE-ValueType
WD40 94 154 2.48e0 SMART
WD40 157 196 7.99e-1 SMART
WD40 202 242 3.7e0 SMART
WD40 245 285 3.58e-1 SMART
WD40 329 368 5.52e-2 SMART
WD40 371 409 1.1e1 SMART
WD40 412 451 4.95e-4 SMART
WD40 458 497 4.62e-4 SMART
WD40 523 564 4.75e1 SMART
WD40 570 610 2.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148246
SMART Domains Protein: ENSMUSP00000115466
Gene: ENSMUSG00000040811

DomainStartEndE-ValueType
WD40 94 143 8.36e-2 SMART
WD40 146 191 9.21e0 SMART
WD40 194 233 7.99e-1 SMART
WD40 239 279 3.7e0 SMART
WD40 282 322 3.58e-1 SMART
WD40 366 405 5.52e-2 SMART
Meta Mutation Damage Score 0.2533 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,686,450 (GRCm39) T281A possibly damaging Het
4930503B20Rik A G 3: 146,352,018 (GRCm39) probably benign Het
6330409D20Rik T A 2: 32,630,552 (GRCm39) probably benign Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Amigo2 A G 15: 97,143,942 (GRCm39) F160S probably damaging Het
Arcn1 A T 9: 44,671,324 (GRCm39) L68M probably damaging Het
Arhgef25 A G 10: 127,020,978 (GRCm39) S303P probably damaging Het
Asph A T 4: 9,607,830 (GRCm39) S163T probably damaging Het
Birc6 T C 17: 74,913,136 (GRCm39) probably benign Het
Bltp3a A G 17: 28,075,737 (GRCm39) I5V probably benign Het
Ccm2 G A 11: 6,511,181 (GRCm39) probably benign Het
Cdc42bpa T C 1: 179,899,978 (GRCm39) V431A probably benign Het
Cdh20 T A 1: 110,065,730 (GRCm39) M668K probably damaging Het
Cfap43 A T 19: 47,814,364 (GRCm39) W157R probably damaging Het
Chrm5 T C 2: 112,310,729 (GRCm39) Y129C probably damaging Het
Chrna5 A G 9: 54,913,803 (GRCm39) I421V possibly damaging Het
Clk1 T A 1: 58,453,772 (GRCm39) T301S probably benign Het
Col6a3 G T 1: 90,744,260 (GRCm39) probably null Het
Fbxw19 T C 9: 109,313,496 (GRCm39) Y234C probably benign Het
Fgd4 T A 16: 16,302,006 (GRCm39) N183I probably benign Het
Fnip2 T C 3: 79,479,845 (GRCm39) probably benign Het
Gask1a T G 9: 121,794,727 (GRCm39) S294A probably benign Het
Gm9847 T A 12: 14,545,016 (GRCm39) noncoding transcript Het
H2-T23 A G 17: 36,343,499 (GRCm39) probably null Het
Hdlbp T C 1: 93,347,915 (GRCm39) E613G probably damaging Het
Kat6a G A 8: 23,401,729 (GRCm39) R366H probably damaging Het
Kctd4 A G 14: 76,200,127 (GRCm39) T33A probably benign Het
Klrb1c T A 6: 128,757,262 (GRCm39) S268C probably benign Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Lrrfip1 A G 1: 91,042,330 (GRCm39) E245G probably damaging Het
Mast3 A T 8: 71,240,889 (GRCm39) I220N probably damaging Het
Mfap3 A G 11: 57,420,639 (GRCm39) T207A probably damaging Het
Mtdh G T 15: 34,118,150 (GRCm39) K75N probably damaging Het
Mybpc1 A G 10: 88,372,213 (GRCm39) Y806H probably damaging Het
Ntng1 T C 3: 109,842,299 (GRCm39) D158G probably damaging Het
Odr4 T A 1: 150,258,140 (GRCm39) D165V probably damaging Het
Or5d46 A G 2: 88,170,092 (GRCm39) Y61C possibly damaging Het
Or6c216 T A 10: 129,678,650 (GRCm39) D87V possibly damaging Het
Pask A G 1: 93,237,805 (GRCm39) probably benign Het
Pif1 G T 9: 65,495,374 (GRCm39) A95S probably benign Het
Plppr2 T C 9: 21,852,428 (GRCm39) F104S probably damaging Het
Prmt9 G A 8: 78,291,626 (GRCm39) V333M probably benign Het
Pten A T 19: 32,792,897 (GRCm39) M239L probably benign Het
Rb1cc1 A G 1: 6,304,454 (GRCm39) D67G probably damaging Het
Reg2 T A 6: 78,382,530 (GRCm39) L12* probably null Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Slc5a7 C A 17: 54,588,750 (GRCm39) probably null Het
Tcaf3 G T 6: 42,570,649 (GRCm39) R368S probably benign Het
Tfcp2 A G 15: 100,418,595 (GRCm39) V189A probably damaging Het
Wdr12 T C 1: 60,126,243 (GRCm39) S191G probably damaging Het
Zfp536 G A 7: 37,180,185 (GRCm39) R807W probably damaging Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Other mutations in Eml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Eml2 APN 7 18,940,068 (GRCm39) missense probably damaging 1.00
IGL00786:Eml2 APN 7 18,936,507 (GRCm39) missense probably damaging 1.00
IGL01084:Eml2 APN 7 18,924,663 (GRCm39) nonsense probably null
IGL01132:Eml2 APN 7 18,934,464 (GRCm39) missense probably damaging 1.00
IGL01678:Eml2 APN 7 18,920,047 (GRCm39) missense probably benign 0.38
IGL01800:Eml2 APN 7 18,935,122 (GRCm39) intron probably benign
IGL02517:Eml2 APN 7 18,940,055 (GRCm39) missense probably damaging 1.00
IGL02607:Eml2 APN 7 18,940,036 (GRCm39) missense probably damaging 1.00
IGL02676:Eml2 APN 7 18,918,846 (GRCm39) nonsense probably null
IGL03082:Eml2 APN 7 18,935,802 (GRCm39) missense probably damaging 1.00
puffery UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R0628_Eml2_697 UTSW 7 18,935,479 (GRCm39) splice site probably benign
R0040:Eml2 UTSW 7 18,930,539 (GRCm39) missense possibly damaging 0.48
R0135:Eml2 UTSW 7 18,937,877 (GRCm39) missense probably damaging 1.00
R0240:Eml2 UTSW 7 18,918,797 (GRCm39) nonsense probably null
R0240:Eml2 UTSW 7 18,918,797 (GRCm39) nonsense probably null
R0362:Eml2 UTSW 7 18,924,731 (GRCm39) splice site probably null
R0387:Eml2 UTSW 7 18,916,184 (GRCm39) splice site probably null
R0432:Eml2 UTSW 7 18,913,456 (GRCm39) nonsense probably null
R0614:Eml2 UTSW 7 18,936,516 (GRCm39) missense probably damaging 1.00
R0628:Eml2 UTSW 7 18,935,479 (GRCm39) splice site probably benign
R1078:Eml2 UTSW 7 18,913,687 (GRCm39) missense probably benign 0.24
R1531:Eml2 UTSW 7 18,930,179 (GRCm39) missense probably damaging 1.00
R1856:Eml2 UTSW 7 18,927,986 (GRCm39) missense probably damaging 0.97
R1864:Eml2 UTSW 7 18,935,803 (GRCm39) missense probably damaging 1.00
R1937:Eml2 UTSW 7 18,937,889 (GRCm39) missense possibly damaging 0.68
R2032:Eml2 UTSW 7 18,936,480 (GRCm39) missense probably benign 0.03
R2185:Eml2 UTSW 7 18,927,953 (GRCm39) missense probably damaging 1.00
R2419:Eml2 UTSW 7 18,910,620 (GRCm39) unclassified probably benign
R3821:Eml2 UTSW 7 18,936,911 (GRCm39) missense possibly damaging 0.94
R4199:Eml2 UTSW 7 18,913,364 (GRCm39) missense probably benign 0.00
R4411:Eml2 UTSW 7 18,916,326 (GRCm39) critical splice donor site probably null
R4497:Eml2 UTSW 7 18,913,275 (GRCm39) missense probably damaging 1.00
R4885:Eml2 UTSW 7 18,937,935 (GRCm39) missense probably benign 0.05
R4912:Eml2 UTSW 7 18,927,924 (GRCm39) splice site probably null
R5028:Eml2 UTSW 7 18,913,372 (GRCm39) critical splice donor site probably null
R5192:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R5373:Eml2 UTSW 7 18,913,188 (GRCm39) missense possibly damaging 0.92
R5718:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R5719:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R5720:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R5727:Eml2 UTSW 7 18,924,685 (GRCm39) missense probably damaging 0.99
R5841:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R5842:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R5843:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R5844:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6014:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6015:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6017:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6073:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6075:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6126:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6128:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6129:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6189:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6190:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6258:Eml2 UTSW 7 18,913,289 (GRCm39) splice site probably null
R6273:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6289:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6376:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6378:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6381:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6384:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6394:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6435:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6436:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6437:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6476:Eml2 UTSW 7 18,930,236 (GRCm39) missense probably benign 0.26
R6550:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6551:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6552:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6554:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6572:Eml2 UTSW 7 18,930,539 (GRCm39) missense possibly damaging 0.48
R6598:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6599:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6704:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6705:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6709:Eml2 UTSW 7 18,940,136 (GRCm39) makesense probably null
R6730:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6734:Eml2 UTSW 7 18,934,432 (GRCm39) missense probably benign 0.35
R6742:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6769:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6770:Eml2 UTSW 7 18,935,088 (GRCm39) missense probably damaging 1.00
R6864:Eml2 UTSW 7 18,930,206 (GRCm39) missense probably damaging 0.99
R6878:Eml2 UTSW 7 18,934,537 (GRCm39) missense probably benign 0.08
R7045:Eml2 UTSW 7 18,935,504 (GRCm39) missense probably damaging 1.00
R7260:Eml2 UTSW 7 18,934,515 (GRCm39) missense probably benign 0.45
R7478:Eml2 UTSW 7 18,940,066 (GRCm39) nonsense probably null
R7706:Eml2 UTSW 7 18,920,035 (GRCm39) missense possibly damaging 0.79
R7811:Eml2 UTSW 7 18,920,047 (GRCm39) missense probably benign 0.38
R8084:Eml2 UTSW 7 18,915,149 (GRCm39) critical splice donor site probably null
R8337:Eml2 UTSW 7 18,930,161 (GRCm39) missense possibly damaging 0.84
R8414:Eml2 UTSW 7 18,913,220 (GRCm39) missense probably damaging 1.00
R8868:Eml2 UTSW 7 18,927,988 (GRCm39) missense probably benign 0.03
R8934:Eml2 UTSW 7 18,913,738 (GRCm39) missense probably damaging 0.99
R9110:Eml2 UTSW 7 18,925,620 (GRCm39) missense probably benign 0.07
R9131:Eml2 UTSW 7 18,918,751 (GRCm39) missense
R9144:Eml2 UTSW 7 18,935,564 (GRCm39) missense possibly damaging 0.75
R9261:Eml2 UTSW 7 18,913,743 (GRCm39) missense probably benign 0.45
R9285:Eml2 UTSW 7 18,925,568 (GRCm39) missense probably damaging 0.98
R9767:Eml2 UTSW 7 18,920,083 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAAGAAATGGGGATGGCTTCTG -3'
(R):5'- TGTGACAGGCTGAGATGAAC -3'

Sequencing Primer
(F):5'- CTTCTGGTGGTTTCTGTAAGGCATC -3'
(R):5'- GGATTGAAGCAGCAGGTT -3'
Posted On 2016-07-06