Mutagenetix > Incidental Mutation

Incidental Mutation 'R5196:Mast3'

400246

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

042772-MU

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5196 (G1)

Quality Score

193

Status

Validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 70788245 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 220 (I220N)

Ref Sequence

ENSEMBL: ENSMUSP00000148686 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212001] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875]

AlphaFold

Q3U214

Predicted Effect

probably damaging
Transcript: ENSMUST00000166004
AA Change: I236N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: I236N

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211841

Predicted Effect

probably damaging
Transcript: ENSMUST00000211948
AA Change: I220N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000212001

Predicted Effect

probably benign
Transcript: ENSMUST00000212038

Predicted Effect

probably benign
Transcript: ENSMUST00000212140

Predicted Effect

probably benign
Transcript: ENSMUST00000212551

Predicted Effect

probably benign
Transcript: ENSMUST00000212673

Predicted Effect

probably benign
Transcript: ENSMUST00000212757

Predicted Effect

probably benign
Transcript: ENSMUST00000212875

Meta Mutation Damage Score

0.9576

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

100% (62/62)

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001O22Rik	T	C	2: 30,796,438	T281A	possibly damaging	Het
4930503B20Rik	A	G	3: 146,646,263		probably benign	Het
6330409D20Rik	T	A	2: 32,740,540		probably benign	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Amigo2	A	G	15: 97,246,061	F160S	probably damaging	Het
Arcn1	A	T	9: 44,760,027	L68M	probably damaging	Het
Arhgef25	A	G	10: 127,185,109	S303P	probably damaging	Het
Asph	A	T	4: 9,607,830	S163T	probably damaging	Het
BC003331	T	A	1: 150,382,389	D165V	probably damaging	Het
Birc6	T	C	17: 74,606,141		probably benign	Het
Ccm2	G	A	11: 6,561,181		probably benign	Het
Cdc42bpa	T	C	1: 180,072,413	V431A	probably benign	Het
Cdh7	T	A	1: 110,138,000	M668K	probably damaging	Het
Cfap43	A	T	19: 47,825,925	W157R	probably damaging	Het
Chrm5	T	C	2: 112,480,384	Y129C	probably damaging	Het
Chrna5	A	G	9: 55,006,519	I421V	possibly damaging	Het
Clk1	T	A	1: 58,414,613	T301S	probably benign	Het
Col6a3	G	T	1: 90,816,538		probably null	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fam198a	T	G	9: 121,965,661	S294A	probably benign	Het
Fbxw19	T	C	9: 109,484,428	Y234C	probably benign	Het
Fgd4	T	A	16: 16,484,142	N183I	probably benign	Het
Fnip2	T	C	3: 79,572,538		probably benign	Het
Gm9847	T	A	12: 14,495,015		noncoding transcript	Het
H2-T23	A	G	17: 36,032,607		probably null	Het
Hdlbp	T	C	1: 93,420,193	E613G	probably damaging	Het
Kat6a	G	A	8: 22,911,713	R366H	probably damaging	Het
Kctd4	A	G	14: 75,962,687	T33A	probably benign	Het
Klrb1c	T	A	6: 128,780,299	S268C	probably benign	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lrrfip1	A	G	1: 91,114,608	E245G	probably damaging	Het
Mfap3	A	G	11: 57,529,813	T207A	probably damaging	Het
Mtdh	G	T	15: 34,118,004	K75N	probably damaging	Het
Mybpc1	A	G	10: 88,536,351	Y806H	probably damaging	Het
Ntng1	T	C	3: 109,934,983	D158G	probably damaging	Het
Olfr1176	A	G	2: 88,339,748	Y61C	possibly damaging	Het
Olfr812	T	A	10: 129,842,781	D87V	possibly damaging	Het
Pask	A	G	1: 93,310,083		probably benign	Het
Pif1	G	T	9: 65,588,092	A95S	probably benign	Het
Plppr2	T	C	9: 21,941,132	F104S	probably damaging	Het
Prmt9	G	A	8: 77,564,997	V333M	probably benign	Het
Pten	A	T	19: 32,815,497	M239L	probably benign	Het
Rb1cc1	A	G	1: 6,234,230	D67G	probably damaging	Het
Reg2	T	A	6: 78,405,547	L12*	probably null	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Slc5a7	C	A	17: 54,281,722		probably null	Het
Tcaf3	G	T	6: 42,593,715	R368S	probably benign	Het
Tfcp2	A	G	15: 100,520,714	V189A	probably damaging	Het
Uhrf1bp1	A	G	17: 27,856,763	I5V	probably benign	Het
Wdr12	T	C	1: 60,087,084	S191G	probably damaging	Het
Zfp536	G	A	7: 37,480,760	R807W	probably damaging	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACCTATAGGGGACAGCCATG -3'
(R):5'- AGACTTCTGGACTGTCCTCTG -3'

Sequencing Primer
(F):5'- ATGGCTCCGCAGACTCCAC -3'
(R):5'- GGACTGTCCTCTGATCCATTTCTG -3'

Posted On

2016-07-06