Incidental Mutation 'R5196:Prmt9'
ID400249
Institutional Source Beutler Lab
Gene Symbol Prmt9
Ensembl Gene ENSMUSG00000037134
Gene Nameprotein arginine methyltransferase 9
SynonymsPrmt10
MMRRC Submission 042772-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R5196 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location77549397-77581338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 77564997 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 333 (V333M)
Ref Sequence ENSEMBL: ENSMUSP00000112692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056237] [ENSMUST00000118622] [ENSMUST00000210040]
Predicted Effect probably benign
Transcript: ENSMUST00000056237
AA Change: V333M

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000050181
Gene: ENSMUSG00000037134
AA Change: V333M

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:TPR_11 67 132 1.2e-7 PFAM
Pfam:TPR_2 102 134 7.9e-5 PFAM
Pfam:PrmA 168 257 2.5e-10 PFAM
internal_repeat_1 585 836 1.37e-10 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000118622
AA Change: V333M

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112692
Gene: ENSMUSG00000037134
AA Change: V333M

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:TPR_2 102 134 3e-5 PFAM
Pfam:PrmA 168 257 4.9e-10 PFAM
internal_repeat_1 585 836 1.05e-10 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157125
Predicted Effect probably benign
Transcript: ENSMUST00000210040
Meta Mutation Damage Score 0.0945 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,796,438 T281A possibly damaging Het
4930503B20Rik A G 3: 146,646,263 probably benign Het
6330409D20Rik T A 2: 32,740,540 probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Amigo2 A G 15: 97,246,061 F160S probably damaging Het
Arcn1 A T 9: 44,760,027 L68M probably damaging Het
Arhgef25 A G 10: 127,185,109 S303P probably damaging Het
Asph A T 4: 9,607,830 S163T probably damaging Het
BC003331 T A 1: 150,382,389 D165V probably damaging Het
Birc6 T C 17: 74,606,141 probably benign Het
Ccm2 G A 11: 6,561,181 probably benign Het
Cdc42bpa T C 1: 180,072,413 V431A probably benign Het
Cdh7 T A 1: 110,138,000 M668K probably damaging Het
Cfap43 A T 19: 47,825,925 W157R probably damaging Het
Chrm5 T C 2: 112,480,384 Y129C probably damaging Het
Chrna5 A G 9: 55,006,519 I421V possibly damaging Het
Clk1 T A 1: 58,414,613 T301S probably benign Het
Col6a3 G T 1: 90,816,538 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam198a T G 9: 121,965,661 S294A probably benign Het
Fbxw19 T C 9: 109,484,428 Y234C probably benign Het
Fgd4 T A 16: 16,484,142 N183I probably benign Het
Fnip2 T C 3: 79,572,538 probably benign Het
Gm9847 T A 12: 14,495,015 noncoding transcript Het
H2-T23 A G 17: 36,032,607 probably null Het
Hdlbp T C 1: 93,420,193 E613G probably damaging Het
Kat6a G A 8: 22,911,713 R366H probably damaging Het
Kctd4 A G 14: 75,962,687 T33A probably benign Het
Klrb1c T A 6: 128,780,299 S268C probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrfip1 A G 1: 91,114,608 E245G probably damaging Het
Mast3 A T 8: 70,788,245 I220N probably damaging Het
Mfap3 A G 11: 57,529,813 T207A probably damaging Het
Mtdh G T 15: 34,118,004 K75N probably damaging Het
Mybpc1 A G 10: 88,536,351 Y806H probably damaging Het
Ntng1 T C 3: 109,934,983 D158G probably damaging Het
Olfr1176 A G 2: 88,339,748 Y61C possibly damaging Het
Olfr812 T A 10: 129,842,781 D87V possibly damaging Het
Pask A G 1: 93,310,083 probably benign Het
Pif1 G T 9: 65,588,092 A95S probably benign Het
Plppr2 T C 9: 21,941,132 F104S probably damaging Het
Pten A T 19: 32,815,497 M239L probably benign Het
Rb1cc1 A G 1: 6,234,230 D67G probably damaging Het
Reg2 T A 6: 78,405,547 L12* probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc5a7 C A 17: 54,281,722 probably null Het
Tcaf3 G T 6: 42,593,715 R368S probably benign Het
Tfcp2 A G 15: 100,520,714 V189A probably damaging Het
Uhrf1bp1 A G 17: 27,856,763 I5V probably benign Het
Wdr12 T C 1: 60,087,084 S191G probably damaging Het
Zfp536 G A 7: 37,480,760 R807W probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Prmt9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01801:Prmt9 APN 8 77562440 missense probably damaging 1.00
IGL02306:Prmt9 APN 8 77560818 missense probably benign 0.06
IGL02971:Prmt9 APN 8 77565069 missense probably benign 0.00
1mM(1):Prmt9 UTSW 8 77555764 missense probably benign 0.01
R0004:Prmt9 UTSW 8 77555782 missense possibly damaging 0.81
R0928:Prmt9 UTSW 8 77581176 missense probably damaging 1.00
R1328:Prmt9 UTSW 8 77572654 missense possibly damaging 0.86
R1777:Prmt9 UTSW 8 77565108 missense probably benign 0.05
R1826:Prmt9 UTSW 8 77555674 nonsense probably null
R1925:Prmt9 UTSW 8 77577339 missense possibly damaging 0.52
R3855:Prmt9 UTSW 8 77568265 missense probably benign 0.22
R3856:Prmt9 UTSW 8 77568265 missense probably benign 0.22
R4089:Prmt9 UTSW 8 77572545 missense probably benign 0.00
R4963:Prmt9 UTSW 8 77555729 missense probably damaging 1.00
R5413:Prmt9 UTSW 8 77572009 missense possibly damaging 0.95
R5975:Prmt9 UTSW 8 77561018 intron probably benign
R6271:Prmt9 UTSW 8 77577463 missense probably damaging 0.96
R7023:Prmt9 UTSW 8 77549457 start gained probably benign
R7107:Prmt9 UTSW 8 77568251 missense possibly damaging 0.62
R7159:Prmt9 UTSW 8 77555764 missense probably benign 0.01
R7209:Prmt9 UTSW 8 77564998 missense probably benign 0.32
R7770:Prmt9 UTSW 8 77559185 intron probably null
R7819:Prmt9 UTSW 8 77568344 missense probably benign 0.11
X0027:Prmt9 UTSW 8 77560883 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TTAAGACACCCGTGGCCATGA -3'
(R):5'- AGCTTCCCCGTCACACTGAA -3'

Sequencing Primer
(F):5'- CCCGTGGCCATGAGGTTTTATTTC -3'
(R):5'- CCTGCTCTAAAGAGTGAGTTCCAG -3'
Posted On2016-07-06