Incidental Mutation 'R0456:Pdp2'
ID 40025
Institutional Source Beutler Lab
Gene Symbol Pdp2
Ensembl Gene ENSMUSG00000048371
Gene Name pyruvate dehydrogenase phosphatase catalytic subunit 2
Synonyms LOC382051, 4833426J09Rik
MMRRC Submission 038656-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.130) question?
Stock # R0456 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 105318104-105325658 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 105320421 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 90 (R90L)
Ref Sequence ENSEMBL: ENSMUSP00000092821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059588]
AlphaFold Q504M2
Predicted Effect probably damaging
Transcript: ENSMUST00000059588
AA Change: R90L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092821
Gene: ENSMUSG00000048371
AA Change: R90L

DomainStartEndE-ValueType
PP2Cc 96 518 1.1e-92 SMART
PP2C_SIG 121 520 2.56e-1 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a mitochondrial protein that functions as a phosphatase and is involved in the enzymatic resetting of the pyruvate dehydrogenase complex. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 G A 18: 12,429,036 (GRCm39) P11L probably damaging Het
Antxr1 A C 6: 87,194,257 (GRCm39) V347G probably damaging Het
Atp13a5 T C 16: 29,051,492 (GRCm39) N1127D probably benign Het
Bivm T A 1: 44,165,969 (GRCm39) W140R probably damaging Het
Camta1 C A 4: 151,159,597 (GRCm39) R1614L probably damaging Het
Ceacam5 T C 7: 17,494,776 (GRCm39) V928A possibly damaging Het
Chia1 T C 3: 106,035,795 (GRCm39) Y152H probably damaging Het
Chsy3 A T 18: 59,309,550 (GRCm39) I268F probably damaging Het
CK137956 A T 4: 127,839,100 (GRCm39) N439K probably damaging Het
Csf3r C A 4: 125,929,654 (GRCm39) N392K probably damaging Het
Cyp1b1 T C 17: 80,017,704 (GRCm39) I484V probably benign Het
Dsc1 T C 18: 20,232,169 (GRCm39) K280E probably damaging Het
Eefsec A G 6: 88,274,870 (GRCm39) Y365H probably benign Het
Epb41l4b C T 4: 57,142,843 (GRCm39) probably null Het
Erap1 G A 13: 74,812,339 (GRCm39) V385I probably benign Het
Fat1 A T 8: 45,482,571 (GRCm39) I3077F probably damaging Het
Fras1 T G 5: 96,862,202 (GRCm39) probably null Het
Fras1 G T 5: 96,702,647 (GRCm39) G230C probably damaging Het
Gsg1l A G 7: 125,522,682 (GRCm39) M182T possibly damaging Het
Gzmg A G 14: 56,395,779 (GRCm39) V60A probably damaging Het
H4c6 T C 13: 23,735,561 (GRCm39) D86G probably damaging Het
Hapln4 A T 8: 70,537,645 (GRCm39) Y113F probably benign Het
Ikzf4 T A 10: 128,471,677 (GRCm39) T274S probably damaging Het
Kansl1l T A 1: 66,774,885 (GRCm39) H302L probably damaging Het
Klhl41 T C 2: 69,500,893 (GRCm39) V118A probably damaging Het
Kpna1 T C 16: 35,823,270 (GRCm39) S41P possibly damaging Het
Krt23 A G 11: 99,377,604 (GRCm39) V134A probably benign Het
Lamb1 G A 12: 31,354,729 (GRCm39) C992Y probably damaging Het
Lrif1 C T 3: 106,639,094 (GRCm39) P35S probably benign Het
Lrrc4 A G 6: 28,831,103 (GRCm39) S171P probably damaging Het
Lvrn G A 18: 46,997,883 (GRCm39) probably null Het
Matr3 T A 18: 35,705,917 (GRCm39) F281I probably damaging Het
Meak7 A T 8: 120,495,162 (GRCm39) F199I probably damaging Het
Nxn G A 11: 76,153,963 (GRCm39) Q291* probably null Het
Or5b113 A G 19: 13,342,102 (GRCm39) T37A probably damaging Het
Ppp1r3c C A 19: 36,711,291 (GRCm39) E160* probably null Het
Ppp2r5c T G 12: 110,489,013 (GRCm39) S118R probably damaging Het
Ptpn23 G T 9: 110,218,861 (GRCm39) probably null Het
Ptpro G T 6: 137,391,228 (GRCm39) V783L probably benign Het
Rab40c A G 17: 26,103,631 (GRCm39) V144A possibly damaging Het
Rasal2 T C 1: 156,977,413 (GRCm39) N1087S probably damaging Het
Rfc3 T A 5: 151,570,988 (GRCm39) S103C possibly damaging Het
Rgl2 A G 17: 34,155,823 (GRCm39) probably null Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rit2 A T 18: 31,108,504 (GRCm39) F160L probably benign Het
Rnh1 A G 7: 140,742,461 (GRCm39) S366P possibly damaging Het
Sdk2 T C 11: 113,682,292 (GRCm39) Y2029C possibly damaging Het
Smpd3 T A 8: 106,986,288 (GRCm39) I505F probably benign Het
Sorcs3 A T 19: 48,642,483 (GRCm39) S379C possibly damaging Het
Sult1e1 A G 5: 87,726,493 (GRCm39) L207P possibly damaging Het
Sycp2 C G 2: 178,023,648 (GRCm39) S456T probably benign Het
Syne1 T C 10: 5,292,252 (GRCm39) T1339A probably benign Het
Tas2r117 A G 6: 132,780,354 (GRCm39) N164S probably benign Het
Tigd3 A G 19: 5,942,821 (GRCm39) L103P probably damaging Het
Tmem132b T C 5: 125,864,788 (GRCm39) S965P probably damaging Het
Tmem82 T C 4: 141,344,701 (GRCm39) T81A probably benign Het
Tmem8b A G 4: 43,685,618 (GRCm39) T156A probably benign Het
Tnfrsf21 A G 17: 43,348,982 (GRCm39) E198G probably benign Het
Tnpo2 A G 8: 85,781,045 (GRCm39) N767S probably damaging Het
Trf T C 9: 103,104,102 (GRCm39) Y87C probably damaging Het
Tst A G 15: 78,289,780 (GRCm39) V85A probably damaging Het
Usp37 A T 1: 74,507,507 (GRCm39) N503K probably damaging Het
Utp20 C T 10: 88,590,435 (GRCm39) M2346I possibly damaging Het
Vax2 A G 6: 83,688,388 (GRCm39) D37G probably benign Het
Vmn1r77 T A 7: 11,775,665 (GRCm39) L79* probably null Het
Zbtb3 A T 19: 8,780,564 (GRCm39) D59V probably damaging Het
Zdhhc13 T C 7: 48,458,602 (GRCm39) F182S probably benign Het
Zfp426 A G 9: 20,381,593 (GRCm39) F465L probably damaging Het
Zfp526 A G 7: 24,925,637 (GRCm39) E632G probably damaging Het
Other mutations in Pdp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Pdp2 APN 8 105,320,829 (GRCm39) missense probably benign
IGL01771:Pdp2 APN 8 105,320,754 (GRCm39) missense probably benign 0.06
IGL01946:Pdp2 APN 8 105,320,824 (GRCm39) missense probably benign 0.00
IGL02313:Pdp2 APN 8 105,321,531 (GRCm39) missense probably benign 0.44
IGL02588:Pdp2 APN 8 105,321,536 (GRCm39) missense possibly damaging 0.73
IGL02981:Pdp2 APN 8 105,320,267 (GRCm39) missense probably benign 0.00
R1260:Pdp2 UTSW 8 105,321,249 (GRCm39) missense probably damaging 0.96
R1974:Pdp2 UTSW 8 105,320,538 (GRCm39) missense probably benign
R3008:Pdp2 UTSW 8 105,320,898 (GRCm39) missense probably benign 0.08
R4580:Pdp2 UTSW 8 105,321,576 (GRCm39) missense probably damaging 1.00
R4655:Pdp2 UTSW 8 105,321,168 (GRCm39) missense probably benign 0.03
R5677:Pdp2 UTSW 8 105,321,320 (GRCm39) missense probably damaging 1.00
R6813:Pdp2 UTSW 8 105,321,131 (GRCm39) missense probably damaging 1.00
R8176:Pdp2 UTSW 8 105,321,687 (GRCm39) missense probably damaging 1.00
R8472:Pdp2 UTSW 8 105,320,913 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCACCTGCCACTTGTTTCAGAATG -3'
(R):5'- AAAGCCTCTCACTCACCGCTTG -3'

Sequencing Primer
(F):5'- CTGCAAGGAATCGTATTGCTC -3'
(R):5'- ATTCGTTTGGACGCAGGT -3'
Posted On 2013-05-23