Incidental Mutation 'R5196:Arcn1'
ID 400252
Institutional Source Beutler Lab
Gene Symbol Arcn1
Ensembl Gene ENSMUSG00000032096
Gene Name archain 1
Synonyms 4632432M07Rik, pale coat neuro, nur17
MMRRC Submission 042772-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5196 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 44741564-44767845 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 44760027 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Methionine at position 68 (L68M)
Ref Sequence ENSEMBL: ENSMUSP00000034607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034607]
AlphaFold Q5XJY5
Predicted Effect probably damaging
Transcript: ENSMUST00000034607
AA Change: L68M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034607
Gene: ENSMUSG00000032096
AA Change: L68M

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 3 140 5.6e-8 PFAM
coiled coil region 145 180 N/A INTRINSIC
low complexity region 200 207 N/A INTRINSIC
Pfam:Adap_comp_sub 261 510 6.8e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215140
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217199
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene maps in a region, which include the mixed lineage leukemia and Friend leukemia virus integration 1 genes, where multiple disease-associated chromosome translocations occur. It is an intracellular protein. Archain sequences are well conserved among eukaryotes and this protein may play a fundamental role in eukaryotic cell biology. It has similarities to heat shock proteins and clathrin-associated proteins, and may be involved in vesicle structure or trafficking. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation have a dilute coat color and neurological defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,796,438 T281A possibly damaging Het
4930503B20Rik A G 3: 146,646,263 probably benign Het
6330409D20Rik T A 2: 32,740,540 probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Amigo2 A G 15: 97,246,061 F160S probably damaging Het
Arhgef25 A G 10: 127,185,109 S303P probably damaging Het
Asph A T 4: 9,607,830 S163T probably damaging Het
BC003331 T A 1: 150,382,389 D165V probably damaging Het
Birc6 T C 17: 74,606,141 probably benign Het
Ccm2 G A 11: 6,561,181 probably benign Het
Cdc42bpa T C 1: 180,072,413 V431A probably benign Het
Cdh7 T A 1: 110,138,000 M668K probably damaging Het
Cfap43 A T 19: 47,825,925 W157R probably damaging Het
Chrm5 T C 2: 112,480,384 Y129C probably damaging Het
Chrna5 A G 9: 55,006,519 I421V possibly damaging Het
Clk1 T A 1: 58,414,613 T301S probably benign Het
Col6a3 G T 1: 90,816,538 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam198a T G 9: 121,965,661 S294A probably benign Het
Fbxw19 T C 9: 109,484,428 Y234C probably benign Het
Fgd4 T A 16: 16,484,142 N183I probably benign Het
Fnip2 T C 3: 79,572,538 probably benign Het
Gm9847 T A 12: 14,495,015 noncoding transcript Het
H2-T23 A G 17: 36,032,607 probably null Het
Hdlbp T C 1: 93,420,193 E613G probably damaging Het
Kat6a G A 8: 22,911,713 R366H probably damaging Het
Kctd4 A G 14: 75,962,687 T33A probably benign Het
Klrb1c T A 6: 128,780,299 S268C probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrfip1 A G 1: 91,114,608 E245G probably damaging Het
Mast3 A T 8: 70,788,245 I220N probably damaging Het
Mfap3 A G 11: 57,529,813 T207A probably damaging Het
Mtdh G T 15: 34,118,004 K75N probably damaging Het
Mybpc1 A G 10: 88,536,351 Y806H probably damaging Het
Ntng1 T C 3: 109,934,983 D158G probably damaging Het
Olfr1176 A G 2: 88,339,748 Y61C possibly damaging Het
Olfr812 T A 10: 129,842,781 D87V possibly damaging Het
Pask A G 1: 93,310,083 probably benign Het
Pif1 G T 9: 65,588,092 A95S probably benign Het
Plppr2 T C 9: 21,941,132 F104S probably damaging Het
Prmt9 G A 8: 77,564,997 V333M probably benign Het
Pten A T 19: 32,815,497 M239L probably benign Het
Rb1cc1 A G 1: 6,234,230 D67G probably damaging Het
Reg2 T A 6: 78,405,547 L12* probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc5a7 C A 17: 54,281,722 probably null Het
Tcaf3 G T 6: 42,593,715 R368S probably benign Het
Tfcp2 A G 15: 100,520,714 V189A probably damaging Het
Uhrf1bp1 A G 17: 27,856,763 I5V probably benign Het
Wdr12 T C 1: 60,087,084 S191G probably damaging Het
Zfp536 G A 7: 37,480,760 R807W probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Arcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Arcn1 APN 9 44759036 nonsense probably null
IGL00473:Arcn1 APN 9 44757147 missense probably benign 0.00
IGL00909:Arcn1 APN 9 44751354 missense probably damaging 1.00
IGL01341:Arcn1 APN 9 44757192 missense possibly damaging 0.82
IGL02074:Arcn1 APN 9 44759012 missense probably benign 0.30
IGL02640:Arcn1 APN 9 44751317 missense probably damaging 0.99
greyhound UTSW 9 44750394 missense possibly damaging 0.92
PIT4402001:Arcn1 UTSW 9 44745602 missense possibly damaging 0.89
R0323:Arcn1 UTSW 9 44759059 missense probably damaging 1.00
R0834:Arcn1 UTSW 9 44758875 splice site probably benign
R1552:Arcn1 UTSW 9 44758994 missense probably damaging 1.00
R5114:Arcn1 UTSW 9 44760144 missense probably benign 0.01
R5327:Arcn1 UTSW 9 44757147 missense probably benign 0.01
R6750:Arcn1 UTSW 9 44750394 missense possibly damaging 0.92
R8809:Arcn1 UTSW 9 44743962 missense possibly damaging 0.75
R9458:Arcn1 UTSW 9 44759970 missense probably damaging 1.00
Z1177:Arcn1 UTSW 9 44757253 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCCAACAAGTGTCTGCTG -3'
(R):5'- AGCGGGAAAGGCTATTGTTTC -3'

Sequencing Primer
(F):5'- CTCAGCGACAGAGTGCTTGTATAG -3'
(R):5'- GAAAGGCTATTGTTTCTCGACAG -3'
Posted On 2016-07-06