Incidental Mutation 'R5196:Pif1'
ID400256
Institutional Source Beutler Lab
Gene Symbol Pif1
Ensembl Gene ENSMUSG00000041064
Gene NamePIF1 5'-to-3' DNA helicase
SynonymsAI449441
MMRRC Submission 042772-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5196 (G1)
Quality Score84
Status Validated
Chromosome9
Chromosomal Location65587160-65595967 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 65588092 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 95 (A95S)
Ref Sequence ENSEMBL: ENSMUSP00000117085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047099] [ENSMUST00000131483] [ENSMUST00000134538] [ENSMUST00000136205] [ENSMUST00000141046] [ENSMUST00000154970]
Predicted Effect probably benign
Transcript: ENSMUST00000047099
AA Change: A95S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000049046
Gene: ENSMUSG00000041064
AA Change: A95S

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
Pfam:AAA_30 215 426 1.8e-15 PFAM
Pfam:PIF1 215 513 2.1e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131483
AA Change: A95S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000117494
Gene: ENSMUSG00000041064
AA Change: A95S

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
Pfam:AAA_30 215 426 1.8e-15 PFAM
Pfam:PIF1 215 513 2.1e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134538
AA Change: A95S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000122060
Gene: ENSMUSG00000041064
AA Change: A95S

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
Pfam:AAA_30 215 426 1.8e-15 PFAM
Pfam:PIF1 215 513 2.1e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136205
Predicted Effect probably benign
Transcript: ENSMUST00000141046
AA Change: A95S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000120400
Gene: ENSMUSG00000041064
AA Change: A95S

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152885
Predicted Effect probably benign
Transcript: ENSMUST00000154970
AA Change: A95S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000117085
Gene: ENSMUSG00000041064
AA Change: A95S

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
Pfam:AAA_30 215 410 1e-14 PFAM
Pfam:PIF1 215 410 8e-59 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-dependent adenosine triphosphate (ATP)-metabolizing enzyme that functions as a 5' to 3' DNA helicase. The encoded protein can resolve G-quadruplex structures and RNA-DNA hybrids at the ends of chromosomes. It also prevents telomere elongation by inhibiting the actions of telomerase. Alternative splicing and the use of alternative start codons results in multiple isoforms that are differentially localized to either the mitochondria or the nucleus. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal and show no evidence of increased sensitivity to DNA damage, genetic instability, reproducible telomere length alteration or other cellular abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,796,438 T281A possibly damaging Het
4930503B20Rik A G 3: 146,646,263 probably benign Het
6330409D20Rik T A 2: 32,740,540 probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Amigo2 A G 15: 97,246,061 F160S probably damaging Het
Arcn1 A T 9: 44,760,027 L68M probably damaging Het
Arhgef25 A G 10: 127,185,109 S303P probably damaging Het
Asph A T 4: 9,607,830 S163T probably damaging Het
BC003331 T A 1: 150,382,389 D165V probably damaging Het
Birc6 T C 17: 74,606,141 probably benign Het
Ccm2 G A 11: 6,561,181 probably benign Het
Cdc42bpa T C 1: 180,072,413 V431A probably benign Het
Cdh7 T A 1: 110,138,000 M668K probably damaging Het
Cfap43 A T 19: 47,825,925 W157R probably damaging Het
Chrm5 T C 2: 112,480,384 Y129C probably damaging Het
Chrna5 A G 9: 55,006,519 I421V possibly damaging Het
Clk1 T A 1: 58,414,613 T301S probably benign Het
Col6a3 G T 1: 90,816,538 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam198a T G 9: 121,965,661 S294A probably benign Het
Fbxw19 T C 9: 109,484,428 Y234C probably benign Het
Fgd4 T A 16: 16,484,142 N183I probably benign Het
Fnip2 T C 3: 79,572,538 probably benign Het
Gm9847 T A 12: 14,495,015 noncoding transcript Het
H2-T23 A G 17: 36,032,607 probably null Het
Hdlbp T C 1: 93,420,193 E613G probably damaging Het
Kat6a G A 8: 22,911,713 R366H probably damaging Het
Kctd4 A G 14: 75,962,687 T33A probably benign Het
Klrb1c T A 6: 128,780,299 S268C probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrfip1 A G 1: 91,114,608 E245G probably damaging Het
Mast3 A T 8: 70,788,245 I220N probably damaging Het
Mfap3 A G 11: 57,529,813 T207A probably damaging Het
Mtdh G T 15: 34,118,004 K75N probably damaging Het
Mybpc1 A G 10: 88,536,351 Y806H probably damaging Het
Ntng1 T C 3: 109,934,983 D158G probably damaging Het
Olfr1176 A G 2: 88,339,748 Y61C possibly damaging Het
Olfr812 T A 10: 129,842,781 D87V possibly damaging Het
Pask A G 1: 93,310,083 probably benign Het
Plppr2 T C 9: 21,941,132 F104S probably damaging Het
Prmt9 G A 8: 77,564,997 V333M probably benign Het
Pten A T 19: 32,815,497 M239L probably benign Het
Rb1cc1 A G 1: 6,234,230 D67G probably damaging Het
Reg2 T A 6: 78,405,547 L12* probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc5a7 C A 17: 54,281,722 probably null Het
Tcaf3 G T 6: 42,593,715 R368S probably benign Het
Tfcp2 A G 15: 100,520,714 V189A probably damaging Het
Uhrf1bp1 A G 17: 27,856,763 I5V probably benign Het
Wdr12 T C 1: 60,087,084 S191G probably damaging Het
Zfp536 G A 7: 37,480,760 R807W probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Pif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Pif1 APN 9 65593277 missense probably damaging 1.00
IGL01343:Pif1 APN 9 65589562 missense probably damaging 1.00
IGL01753:Pif1 APN 9 65593308 missense probably damaging 1.00
R0415:Pif1 UTSW 9 65588051 missense probably benign 0.00
R1087:Pif1 UTSW 9 65589095 missense probably benign
R1742:Pif1 UTSW 9 65587850 missense probably benign 0.12
R1861:Pif1 UTSW 9 65589453 missense probably damaging 1.00
R3804:Pif1 UTSW 9 65588306 missense probably damaging 0.99
R3950:Pif1 UTSW 9 65591834 missense probably damaging 1.00
R4457:Pif1 UTSW 9 65587776 utr 5 prime probably benign
R4853:Pif1 UTSW 9 65593576 missense probably damaging 1.00
R5192:Pif1 UTSW 9 65588092 missense probably benign 0.02
R5269:Pif1 UTSW 9 65591829 missense possibly damaging 0.82
R6703:Pif1 UTSW 9 65593263 missense probably damaging 1.00
R7451:Pif1 UTSW 9 65588348 missense probably benign 0.00
R7556:Pif1 UTSW 9 65589711 critical splice acceptor site probably null
X0064:Pif1 UTSW 9 65594478 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CGATGAATGTGACGATGCG -3'
(R):5'- TGCACTGGACTGATGGTGAC -3'

Sequencing Primer
(F):5'- TAGCCGTGGAGGAGCTG -3'
(R):5'- GACTGATGGTGACAAAGTCTCG -3'
Posted On2016-07-06