Incidental Mutation 'R5271:Olfr1229'
ID 400262
Institutional Source Beutler Lab
Gene Symbol Olfr1229
Ensembl Gene ENSMUSG00000075095
Gene Name olfactory receptor 1229
Synonyms MOR233-19, MOR233-22, GA_x6K02T2Q125-50727797-50726862
MMRRC Submission 042861-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R5271 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 89280476-89288014 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 89282953 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 60 (F60Y)
Ref Sequence ENSEMBL: ENSMUSP00000150344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099788] [ENSMUST00000213883] [ENSMUST00000214593]
AlphaFold Q7TQZ9
Predicted Effect probably benign
Transcript: ENSMUST00000099788
AA Change: F60Y

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097376
Gene: ENSMUSG00000075095
AA Change: F60Y

DomainStartEndE-ValueType
Pfam:7tm_1 39 286 2.9e-29 PFAM
Pfam:7tm_4 138 279 1.7e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111549
AA Change: F81Y

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107174
Gene: ENSMUSG00000075095
AA Change: F81Y

DomainStartEndE-ValueType
transmembrane domain 2 19 N/A INTRINSIC
Pfam:7tm_4 49 324 9.6e-51 PFAM
Pfam:7tm_1 60 307 7.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213883
AA Change: F60Y

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000214593
AA Change: F60Y

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.1126 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T C 3: 124,579,847 K33R possibly damaging Het
4632415L05Rik C T 3: 19,895,147 noncoding transcript Het
4930542C16Rik A C 14: 24,615,530 noncoding transcript Het
Adprh A T 16: 38,446,054 L242* probably null Het
Anapc1 G A 2: 128,685,985 Q18* probably null Het
Bfar T C 16: 13,692,397 probably benign Het
Bmp1 T C 14: 70,508,128 I206V probably benign Het
Cc2d1b T A 4: 108,623,629 probably benign Het
Clock A G 5: 76,241,954 I349T probably damaging Het
Cox11 A G 11: 90,643,732 Y60C probably damaging Het
Cyp1a1 G A 9: 57,702,838 V512M probably benign Het
Dcdc2a T C 13: 25,187,688 F311S probably benign Het
Dnase1l3 T C 14: 7,993,843 D48G probably damaging Het
Engase G T 11: 118,481,397 A172S probably damaging Het
F2 T C 2: 91,635,121 probably benign Het
Gcc2 T C 10: 58,269,695 V215A possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm14548 A T 7: 3,897,567 Y61* probably null Het
Gm20388 A G 8: 122,271,133 probably benign Het
Gm20671 T C 5: 32,819,959 K1817R possibly damaging Het
Gm20939 T A 17: 94,877,155 Y410* probably null Het
Gm27013 T C 6: 130,676,915 Y528C probably damaging Het
Gm9992 T C 17: 7,369,682 N149S possibly damaging Het
Il23r T C 6: 67,423,696 H550R probably benign Het
Iqgap1 A T 7: 80,734,148 V1056E probably damaging Het
Lrit3 T A 3: 129,788,301 Y679F probably damaging Het
Megf8 A T 7: 25,341,706 E1120V probably damaging Het
Mta1 A G 12: 113,131,957 E518G probably damaging Het
Myo9a A G 9: 59,907,382 I2200M probably damaging Het
Ncoa7 T C 10: 30,722,729 H66R probably benign Het
Ncor1 A G 11: 62,340,545 V812A probably damaging Het
Ndnf T C 6: 65,703,666 Y310H possibly damaging Het
Ndst1 G A 18: 60,705,132 T347I probably benign Het
Olfr512 T C 7: 108,714,217 L276S probably damaging Het
Pcdhb10 C A 18: 37,413,169 Q433K probably benign Het
Pcdhb18 G A 18: 37,491,596 V660M possibly damaging Het
Pds5b T A 5: 150,723,353 N202K possibly damaging Het
Polk T C 13: 96,483,539 S718G probably benign Het
Ptpdc1 T C 13: 48,590,698 D149G probably damaging Het
Rb1cc1 T A 1: 6,249,193 C35* probably null Het
Samd9l C T 6: 3,376,156 M368I probably benign Het
Shroom3 T C 5: 92,962,248 M1739T probably damaging Het
Slc18a3 A G 14: 32,463,748 L226P probably damaging Het
St7l A T 3: 104,868,060 Y84F probably damaging Het
Svil A T 18: 5,062,329 N392I probably benign Het
Syngr1 T A 15: 80,098,039 M9K probably benign Het
Taar2 T C 10: 23,941,032 S157P probably damaging Het
Tagap1 G T 17: 6,956,096 Y400* probably null Het
Tbc1d8 T A 1: 39,373,767 E976V probably damaging Het
Tmem163 G A 1: 127,491,552 probably benign Het
Tnfaip2 A G 12: 111,448,460 probably benign Het
Ttn C T 2: 76,706,517 S34988N possibly damaging Het
Tubg1 T G 11: 101,120,238 N15K probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zap70 T A 1: 36,781,365 V547D probably damaging Het
Zfp146 G T 7: 30,162,475 N47K probably benign Het
Znrf1 T G 8: 111,609,344 M159R probably benign Het
Other mutations in Olfr1229
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02982:Olfr1229 APN 2 89283109 missense probably damaging 0.98
R1535:Olfr1229 UTSW 2 89283057 missense probably benign 0.14
R1610:Olfr1229 UTSW 2 89282821 missense probably damaging 1.00
R3896:Olfr1229 UTSW 2 89283097 missense possibly damaging 0.78
R4516:Olfr1229 UTSW 2 89282843 missense probably benign 0.05
R4922:Olfr1229 UTSW 2 89282467 missense possibly damaging 0.93
R4990:Olfr1229 UTSW 2 89283327 splice site probably null
R5267:Olfr1229 UTSW 2 89282230 nonsense probably null
R5514:Olfr1229 UTSW 2 89282473 missense probably damaging 1.00
R5621:Olfr1229 UTSW 2 89282353 missense probably damaging 0.97
R7154:Olfr1229 UTSW 2 89282860 missense probably damaging 1.00
R7992:Olfr1229 UTSW 2 89282738 missense probably benign 0.01
R9028:Olfr1229 UTSW 2 89282332 missense probably damaging 1.00
Z1176:Olfr1229 UTSW 2 89282537 missense probably benign 0.03
Z1176:Olfr1229 UTSW 2 89282897 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCAAATAGCAACATAGCGGTC -3'
(R):5'- GGCATTCATCTTTTCCTTGGAAAC -3'

Sequencing Primer
(F):5'- TCATAGGCCATGGCTGACAG -3'
(R):5'- CTTTTCCTTGGAAACCATGCAAAAC -3'
Posted On 2016-07-06