Incidental Mutation 'R5271:F2'
ID400264
Institutional Source Beutler Lab
Gene Symbol F2
Ensembl Gene ENSMUSG00000027249
Gene Namecoagulation factor II
SynonymsFII, Cf2, Cf-2, thrombin, prothrombin
MMRRC Submission 042861-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5271 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location91625320-91636414 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 91635121 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028681] [ENSMUST00000111335]
Predicted Effect probably benign
Transcript: ENSMUST00000028681
SMART Domains Protein: ENSMUSP00000028681
Gene: ENSMUSG00000027249

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GLA 25 89 1.91e-30 SMART
KR 107 189 7.47e-37 SMART
KR 213 295 5.09e-30 SMART
Tryp_SPc 360 610 9.99e-84 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111335
SMART Domains Protein: ENSMUSP00000106967
Gene: ENSMUSG00000027249

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GLA 25 89 1.91e-30 SMART
KR 107 189 8.01e-37 SMART
KR 212 294 5.09e-30 SMART
Tryp_SPc 359 609 9.99e-84 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153182
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: This gene encodes a vitamin K-dependent glycoprotein coagulation factor that plays an important role in the process of blood coagulation and hemostasis. The encoded protein is an inactive zymogen that undergoes enzymatic cleavage by the coagulation factor Xa to form an active serine protease that converts soluble fibrinogen to insoluble fibrin clot. Most of the mice lacking the encoded protein die at an embryonic stage due to defects in yolk sac vasculature, while the rare nenonates succumb to hemorrhage on the first postnatal day. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects in yolk sac vasculature, internal bleeding, tissue necrosis, and die in mid- to late-gestation, or rarely, a few days after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T C 3: 124,579,847 K33R possibly damaging Het
4632415L05Rik C T 3: 19,895,147 noncoding transcript Het
4930542C16Rik A C 14: 24,615,530 noncoding transcript Het
Adprh A T 16: 38,446,054 L242* probably null Het
Anapc1 G A 2: 128,685,985 Q18* probably null Het
Bfar T C 16: 13,692,397 probably benign Het
Bmp1 T C 14: 70,508,128 I206V probably benign Het
Cc2d1b T A 4: 108,623,629 probably benign Het
Clock A G 5: 76,241,954 I349T probably damaging Het
Cox11 A G 11: 90,643,732 Y60C probably damaging Het
Cyp1a1 G A 9: 57,702,838 V512M probably benign Het
Dcdc2a T C 13: 25,187,688 F311S probably benign Het
Dnase1l3 T C 14: 7,993,843 D48G probably damaging Het
Engase G T 11: 118,481,397 A172S probably damaging Het
Gcc2 T C 10: 58,269,695 V215A possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm14548 A T 7: 3,897,567 Y61* probably null Het
Gm20388 A G 8: 122,271,133 probably benign Het
Gm20671 T C 5: 32,819,959 K1817R possibly damaging Het
Gm20939 T A 17: 94,877,155 Y410* probably null Het
Gm27013 T C 6: 130,676,915 Y528C probably damaging Het
Gm9992 T C 17: 7,369,682 N149S possibly damaging Het
Il23r T C 6: 67,423,696 H550R probably benign Het
Iqgap1 A T 7: 80,734,148 V1056E probably damaging Het
Lrit3 T A 3: 129,788,301 Y679F probably damaging Het
Megf8 A T 7: 25,341,706 E1120V probably damaging Het
Mta1 A G 12: 113,131,957 E518G probably damaging Het
Myo9a A G 9: 59,907,382 I2200M probably damaging Het
Ncoa7 T C 10: 30,722,729 H66R probably benign Het
Ncor1 A G 11: 62,340,545 V812A probably damaging Het
Ndnf T C 6: 65,703,666 Y310H possibly damaging Het
Ndst1 G A 18: 60,705,132 T347I probably benign Het
Olfr1229 A T 2: 89,282,953 F60Y probably benign Het
Olfr512 T C 7: 108,714,217 L276S probably damaging Het
Pcdhb10 C A 18: 37,413,169 Q433K probably benign Het
Pcdhb18 G A 18: 37,491,596 V660M possibly damaging Het
Pds5b T A 5: 150,723,353 N202K possibly damaging Het
Polk T C 13: 96,483,539 S718G probably benign Het
Ptpdc1 T C 13: 48,590,698 D149G probably damaging Het
Rb1cc1 T A 1: 6,249,193 C35* probably null Het
Samd9l C T 6: 3,376,156 M368I probably benign Het
Shroom3 T C 5: 92,962,248 M1739T probably damaging Het
Slc18a3 A G 14: 32,463,748 L226P probably damaging Het
St7l A T 3: 104,868,060 Y84F probably damaging Het
Svil A T 18: 5,062,329 N392I probably benign Het
Syngr1 T A 15: 80,098,039 M9K probably benign Het
Taar2 T C 10: 23,941,032 S157P probably damaging Het
Tagap1 G T 17: 6,956,096 Y400* probably null Het
Tbc1d8 T A 1: 39,373,767 E976V probably damaging Het
Tmem163 G A 1: 127,491,552 probably benign Het
Tnfaip2 A G 12: 111,448,460 probably benign Het
Ttn C T 2: 76,706,517 S34988N possibly damaging Het
Tubg1 T G 11: 101,120,238 N15K probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zap70 T A 1: 36,781,365 V547D probably damaging Het
Zfp146 G T 7: 30,162,475 N47K probably benign Het
Znrf1 T G 8: 111,609,344 M159R probably benign Het
Other mutations in F2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02334:F2 APN 2 91633094 missense probably benign 0.16
IGL02390:F2 APN 2 91632987 missense possibly damaging 0.81
IGL02859:F2 APN 2 91625742 missense probably damaging 1.00
IGL02970:F2 APN 2 91625551 missense possibly damaging 0.95
IGL03278:F2 APN 2 91635182 missense probably benign 0.01
Sarode UTSW 2 91635194 missense probably benign 0.35
R0007:F2 UTSW 2 91630607 missense probably benign 0.00
R0015:F2 UTSW 2 91630607 missense probably benign 0.00
R0137:F2 UTSW 2 91625730 missense probably damaging 1.00
R0211:F2 UTSW 2 91630158 missense probably damaging 1.00
R0304:F2 UTSW 2 91633233 missense probably damaging 0.99
R0601:F2 UTSW 2 91633311 splice site probably null
R0830:F2 UTSW 2 91630200 missense probably benign 0.34
R1693:F2 UTSW 2 91629179 missense probably damaging 1.00
R1720:F2 UTSW 2 91628830 nonsense probably null
R1763:F2 UTSW 2 91634906 missense probably damaging 1.00
R1865:F2 UTSW 2 91635194 missense probably benign 0.35
R1955:F2 UTSW 2 91633095 missense probably benign 0.01
R2055:F2 UTSW 2 91628442 missense probably benign 0.00
R2168:F2 UTSW 2 91628348 missense probably damaging 0.98
R2230:F2 UTSW 2 91625757 missense probably benign 0.01
R3916:F2 UTSW 2 91625488 missense probably damaging 1.00
R4004:F2 UTSW 2 91628396 missense possibly damaging 0.88
R4134:F2 UTSW 2 91629208 missense possibly damaging 0.93
R4298:F2 UTSW 2 91629320 critical splice acceptor site probably null
R4626:F2 UTSW 2 91630670 missense probably benign 0.07
R4902:F2 UTSW 2 91634971 intron probably benign
R5093:F2 UTSW 2 91634957 splice site probably benign
R5095:F2 UTSW 2 91634957 splice site probably benign
R5140:F2 UTSW 2 91634957 splice site probably benign
R5229:F2 UTSW 2 91630241 nonsense probably null
R5335:F2 UTSW 2 91634932 missense possibly damaging 0.68
R7650:F2 UTSW 2 91628396 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CAGTCCATGAAAGTCTCTCGAGG -3'
(R):5'- CAAACTGGGCTCAGGTGGTAAG -3'

Sequencing Primer
(F):5'- ATGAAAGTCTCTCGAGGTTTCC -3'
(R):5'- GCTCAGGTGGTAAGGGAAG -3'
Posted On2016-07-06