Incidental Mutation 'R5196:Olfr812'
ID400265
Institutional Source Beutler Lab
Gene Symbol Olfr812
Ensembl Gene ENSMUSG00000049052
Gene Nameolfactory receptor 812
SynonymsGA_x6K02T2PULF-11521598-11520666, MOR110-1
MMRRC Submission 042772-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5196 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129841418-129846094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129842781 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 87 (D87V)
Ref Sequence ENSEMBL: ENSMUSP00000145482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057775] [ENSMUST00000203571] [ENSMUST00000205013]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057775
AA Change: D87V

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000053359
Gene: ENSMUSG00000049052
AA Change: D87V

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.3e-50 PFAM
Pfam:7tm_1 39 288 9.5e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203571
AA Change: D87V

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145284
Gene: ENSMUSG00000049052
AA Change: D87V

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.3e-50 PFAM
Pfam:7tm_1 39 288 9.5e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000205013
AA Change: D87V

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145482
Gene: ENSMUSG00000049052
AA Change: D87V

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 1.3e-44 PFAM
Pfam:7tm_1 39 288 4.1e-23 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,796,438 T281A possibly damaging Het
4930503B20Rik A G 3: 146,646,263 probably benign Het
6330409D20Rik T A 2: 32,740,540 probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Amigo2 A G 15: 97,246,061 F160S probably damaging Het
Arcn1 A T 9: 44,760,027 L68M probably damaging Het
Arhgef25 A G 10: 127,185,109 S303P probably damaging Het
Asph A T 4: 9,607,830 S163T probably damaging Het
BC003331 T A 1: 150,382,389 D165V probably damaging Het
Birc6 T C 17: 74,606,141 probably benign Het
Ccm2 G A 11: 6,561,181 probably benign Het
Cdc42bpa T C 1: 180,072,413 V431A probably benign Het
Cdh7 T A 1: 110,138,000 M668K probably damaging Het
Cfap43 A T 19: 47,825,925 W157R probably damaging Het
Chrm5 T C 2: 112,480,384 Y129C probably damaging Het
Chrna5 A G 9: 55,006,519 I421V possibly damaging Het
Clk1 T A 1: 58,414,613 T301S probably benign Het
Col6a3 G T 1: 90,816,538 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam198a T G 9: 121,965,661 S294A probably benign Het
Fbxw19 T C 9: 109,484,428 Y234C probably benign Het
Fgd4 T A 16: 16,484,142 N183I probably benign Het
Fnip2 T C 3: 79,572,538 probably benign Het
Gm9847 T A 12: 14,495,015 noncoding transcript Het
H2-T23 A G 17: 36,032,607 probably null Het
Hdlbp T C 1: 93,420,193 E613G probably damaging Het
Kat6a G A 8: 22,911,713 R366H probably damaging Het
Kctd4 A G 14: 75,962,687 T33A probably benign Het
Klrb1c T A 6: 128,780,299 S268C probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrfip1 A G 1: 91,114,608 E245G probably damaging Het
Mast3 A T 8: 70,788,245 I220N probably damaging Het
Mfap3 A G 11: 57,529,813 T207A probably damaging Het
Mtdh G T 15: 34,118,004 K75N probably damaging Het
Mybpc1 A G 10: 88,536,351 Y806H probably damaging Het
Ntng1 T C 3: 109,934,983 D158G probably damaging Het
Olfr1176 A G 2: 88,339,748 Y61C possibly damaging Het
Pask A G 1: 93,310,083 probably benign Het
Pif1 G T 9: 65,588,092 A95S probably benign Het
Plppr2 T C 9: 21,941,132 F104S probably damaging Het
Prmt9 G A 8: 77,564,997 V333M probably benign Het
Pten A T 19: 32,815,497 M239L probably benign Het
Rb1cc1 A G 1: 6,234,230 D67G probably damaging Het
Reg2 T A 6: 78,405,547 L12* probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc5a7 C A 17: 54,281,722 probably null Het
Tcaf3 G T 6: 42,593,715 R368S probably benign Het
Tfcp2 A G 15: 100,520,714 V189A probably damaging Het
Uhrf1bp1 A G 17: 27,856,763 I5V probably benign Het
Wdr12 T C 1: 60,087,084 S191G probably damaging Het
Zfp536 G A 7: 37,480,760 R807W probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Olfr812
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Olfr812 APN 10 129842473 missense probably damaging 1.00
IGL01637:Olfr812 APN 10 129842610 missense probably benign 0.14
IGL02035:Olfr812 APN 10 129842790 missense possibly damaging 0.95
IGL02546:Olfr812 APN 10 129842547 missense probably damaging 0.97
R1902:Olfr812 UTSW 10 129842506 missense probably benign
R4583:Olfr812 UTSW 10 129842475 missense probably damaging 1.00
R4598:Olfr812 UTSW 10 129842995 missense possibly damaging 0.92
R4714:Olfr812 UTSW 10 129842945 missense probably damaging 0.99
R5953:Olfr812 UTSW 10 129842614 missense probably benign 0.22
R6311:Olfr812 UTSW 10 129842907 missense possibly damaging 0.88
R6356:Olfr812 UTSW 10 129842608 missense probably benign 0.14
R6499:Olfr812 UTSW 10 129842584 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAATCCAGTTACCCAGGAGC -3'
(R):5'- AGATGACCCTCAGCTACAAATTCTG -3'

Sequencing Primer
(F):5'- TTACCCAGGAGCTGAGGAC -3'
(R):5'- TCAGCTACAAATTCTGATTTTCCTG -3'
Posted On2016-07-06