Incidental Mutation 'R5196:Ccm2'
ID400267
Institutional Source Beutler Lab
Gene Symbol Ccm2
Ensembl Gene ENSMUSG00000000378
Gene Namecerebral cavernous malformation 2
Synonyms
MMRRC Submission 042772-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5196 (G1)
Quality Score196
Status Validated
Chromosome11
Chromosomal Location6546887-6596744 bp(+) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) G to A at 6561181 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000388] [ENSMUST00000109721] [ENSMUST00000109722] [ENSMUST00000159007] [ENSMUST00000160633] [ENSMUST00000161501]
Predicted Effect probably benign
Transcript: ENSMUST00000000388
SMART Domains Protein: ENSMUSP00000000388
Gene: ENSMUSG00000000378

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Blast:PTB 60 230 2e-35 BLAST
low complexity region 242 252 N/A INTRINSIC
Pfam:CCM2_C 296 396 8.9e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109721
SMART Domains Protein: ENSMUSP00000105343
Gene: ENSMUSG00000000378

DomainStartEndE-ValueType
Blast:PTB 2 166 2e-32 BLAST
low complexity region 178 188 N/A INTRINSIC
low complexity region 230 244 N/A INTRINSIC
PDB:4FQN|D 245 324 5e-52 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000109722
SMART Domains Protein: ENSMUSP00000105344
Gene: ENSMUSG00000000378

DomainStartEndE-ValueType
Blast:PTB 2 166 2e-32 BLAST
low complexity region 178 188 N/A INTRINSIC
low complexity region 230 244 N/A INTRINSIC
PDB:4FQN|D 245 324 5e-52 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118772
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144293
Predicted Effect probably benign
Transcript: ENSMUST00000159007
SMART Domains Protein: ENSMUSP00000125608
Gene: ENSMUSG00000000378

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Blast:PTB 11 102 3e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160633
SMART Domains Protein: ENSMUSP00000125072
Gene: ENSMUSG00000000378

DomainStartEndE-ValueType
Blast:PTB 54 224 6e-38 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000161501
SMART Domains Protein: ENSMUSP00000123790
Gene: ENSMUSG00000000378

DomainStartEndE-ValueType
Blast:PTB 40 122 3e-10 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein that functions in the stress-activated p38 Mitogen-activated protein kinase (MAPK) signaling cascade. The protein interacts with SMAD specific E3 ubiquitin protein ligase 1 (also known as SMURF1) via a phosphotyrosine binding domain to promote RhoA degradation. The protein is required for normal cytoskeletal structure, cell-cell interactions, and lumen formation in endothelial cells. Mutations in this gene result in cerebral cavernous malformations. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous null mice die during embryonic development with vasculature defects in the heart and placenta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,796,438 T281A possibly damaging Het
4930503B20Rik A G 3: 146,646,263 probably benign Het
6330409D20Rik T A 2: 32,740,540 probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Amigo2 A G 15: 97,246,061 F160S probably damaging Het
Arcn1 A T 9: 44,760,027 L68M probably damaging Het
Arhgef25 A G 10: 127,185,109 S303P probably damaging Het
Asph A T 4: 9,607,830 S163T probably damaging Het
BC003331 T A 1: 150,382,389 D165V probably damaging Het
Birc6 T C 17: 74,606,141 probably benign Het
Cdc42bpa T C 1: 180,072,413 V431A probably benign Het
Cdh7 T A 1: 110,138,000 M668K probably damaging Het
Cfap43 A T 19: 47,825,925 W157R probably damaging Het
Chrm5 T C 2: 112,480,384 Y129C probably damaging Het
Chrna5 A G 9: 55,006,519 I421V possibly damaging Het
Clk1 T A 1: 58,414,613 T301S probably benign Het
Col6a3 G T 1: 90,816,538 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam198a T G 9: 121,965,661 S294A probably benign Het
Fbxw19 T C 9: 109,484,428 Y234C probably benign Het
Fgd4 T A 16: 16,484,142 N183I probably benign Het
Fnip2 T C 3: 79,572,538 probably benign Het
Gm9847 T A 12: 14,495,015 noncoding transcript Het
H2-T23 A G 17: 36,032,607 probably null Het
Hdlbp T C 1: 93,420,193 E613G probably damaging Het
Kat6a G A 8: 22,911,713 R366H probably damaging Het
Kctd4 A G 14: 75,962,687 T33A probably benign Het
Klrb1c T A 6: 128,780,299 S268C probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrfip1 A G 1: 91,114,608 E245G probably damaging Het
Mast3 A T 8: 70,788,245 I220N probably damaging Het
Mfap3 A G 11: 57,529,813 T207A probably damaging Het
Mtdh G T 15: 34,118,004 K75N probably damaging Het
Mybpc1 A G 10: 88,536,351 Y806H probably damaging Het
Ntng1 T C 3: 109,934,983 D158G probably damaging Het
Olfr1176 A G 2: 88,339,748 Y61C possibly damaging Het
Olfr812 T A 10: 129,842,781 D87V possibly damaging Het
Pask A G 1: 93,310,083 probably benign Het
Pif1 G T 9: 65,588,092 A95S probably benign Het
Plppr2 T C 9: 21,941,132 F104S probably damaging Het
Prmt9 G A 8: 77,564,997 V333M probably benign Het
Pten A T 19: 32,815,497 M239L probably benign Het
Rb1cc1 A G 1: 6,234,230 D67G probably damaging Het
Reg2 T A 6: 78,405,547 L12* probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc5a7 C A 17: 54,281,722 probably null Het
Tcaf3 G T 6: 42,593,715 R368S probably benign Het
Tfcp2 A G 15: 100,520,714 V189A probably damaging Het
Uhrf1bp1 A G 17: 27,856,763 I5V probably benign Het
Wdr12 T C 1: 60,087,084 S191G probably damaging Het
Zfp536 G A 7: 37,480,760 R807W probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Ccm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02126:Ccm2 APN 11 6594154 missense probably damaging 0.97
IGL02274:Ccm2 APN 11 6590808 missense probably damaging 1.00
IGL02946:Ccm2 APN 11 6596195 missense probably damaging 1.00
IGL02973:Ccm2 APN 11 6584544 missense probably damaging 1.00
R0521:Ccm2 UTSW 11 6590886 missense probably damaging 1.00
R1024:Ccm2 UTSW 11 6570119 nonsense probably null
R1201:Ccm2 UTSW 11 6593682 missense probably benign
R1687:Ccm2 UTSW 11 6585118 missense probably damaging 1.00
R2199:Ccm2 UTSW 11 6590790 missense probably damaging 1.00
R3237:Ccm2 UTSW 11 6570090 missense probably benign 0.43
R6954:Ccm2 UTSW 11 6594239 missense probably damaging 0.98
R7195:Ccm2 UTSW 11 6596302 missense probably damaging 1.00
R7417:Ccm2 UTSW 11 6593091 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGGCTAACAGCTTTTGGATGCTC -3'
(R):5'- CTGTAAAATGAGCCACGCAGC -3'

Sequencing Primer
(F):5'- AACAGCTTTTGGATGCTCTTGCTC -3'
(R):5'- TGAGCCACGCAGCATCTC -3'
Posted On2016-07-06