Incidental Mutation 'R5271:St7l'
ID 400272
Institutional Source Beutler Lab
Gene Symbol St7l
Ensembl Gene ENSMUSG00000045576
Gene Name suppression of tumorigenicity 7-like
Synonyms St7r
MMRRC Submission 042861-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock # R5271 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 104864005-104930064 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 104868060 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 84 (Y84F)
Ref Sequence ENSEMBL: ENSMUSP00000143759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059271] [ENSMUST00000094028] [ENSMUST00000106769] [ENSMUST00000123876] [ENSMUST00000183914] [ENSMUST00000195912] [ENSMUST00000200132]
AlphaFold Q8K4P7
Predicted Effect probably damaging
Transcript: ENSMUST00000059271
AA Change: Y84F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058455
Gene: ENSMUSG00000045576
AA Change: Y84F

DomainStartEndE-ValueType
low complexity region 22 31 N/A INTRINSIC
Pfam:ST7 41 559 1.6e-292 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094028
SMART Domains Protein: ENSMUSP00000102381
Gene: ENSMUSG00000070372

DomainStartEndE-ValueType
Pfam:F-actin_cap_A 14 282 3.1e-109 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106769
AA Change: Y84F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102380
Gene: ENSMUSG00000045576
AA Change: Y84F

DomainStartEndE-ValueType
low complexity region 22 31 N/A INTRINSIC
Pfam:ST7 41 420 8.2e-209 PFAM
Pfam:ST7 419 527 1.4e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123876
AA Change: Y84F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138577
Gene: ENSMUSG00000045576
AA Change: Y84F

DomainStartEndE-ValueType
low complexity region 22 31 N/A INTRINSIC
Pfam:ST7 41 282 6.7e-96 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155476
Predicted Effect probably benign
Transcript: ENSMUST00000183914
SMART Domains Protein: ENSMUSP00000139266
Gene: ENSMUSG00000045576

DomainStartEndE-ValueType
low complexity region 22 31 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195912
SMART Domains Protein: ENSMUSP00000142606
Gene: ENSMUSG00000070372

DomainStartEndE-ValueType
Pfam:F-actin_cap_A 12 75 2.7e-16 PFAM
Pfam:F-actin_cap_A 72 113 1.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199186
Predicted Effect probably damaging
Transcript: ENSMUST00000200132
AA Change: Y84F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143759
Gene: ENSMUSG00000045576
AA Change: Y84F

DomainStartEndE-ValueType
low complexity region 22 31 N/A INTRINSIC
Pfam:ST7 41 212 2.7e-81 PFAM
Pfam:ST7 209 481 1.3e-167 PFAM
Meta Mutation Damage Score 0.3600 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its similarity to the ST7 tumor suppressor gene found in the chromosome 7q31 region. This gene is clustered in a tail-to-tail manner with the WNT2B gene in a chromosomal region known to be deleted and rearranged in a variety of cancers. Several transcript variants encoding many different isoforms have been described, but some have not been fully characterized. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T C 3: 124,579,847 K33R possibly damaging Het
4632415L05Rik C T 3: 19,895,147 noncoding transcript Het
4930542C16Rik A C 14: 24,615,530 noncoding transcript Het
Adprh A T 16: 38,446,054 L242* probably null Het
Anapc1 G A 2: 128,685,985 Q18* probably null Het
Bfar T C 16: 13,692,397 probably benign Het
Bmp1 T C 14: 70,508,128 I206V probably benign Het
Cc2d1b T A 4: 108,623,629 probably benign Het
Clock A G 5: 76,241,954 I349T probably damaging Het
Cox11 A G 11: 90,643,732 Y60C probably damaging Het
Cyp1a1 G A 9: 57,702,838 V512M probably benign Het
Dcdc2a T C 13: 25,187,688 F311S probably benign Het
Dnase1l3 T C 14: 7,993,843 D48G probably damaging Het
Engase G T 11: 118,481,397 A172S probably damaging Het
F2 T C 2: 91,635,121 probably benign Het
Gcc2 T C 10: 58,269,695 V215A possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm14548 A T 7: 3,897,567 Y61* probably null Het
Gm20388 A G 8: 122,271,133 probably benign Het
Gm20671 T C 5: 32,819,959 K1817R possibly damaging Het
Gm20939 T A 17: 94,877,155 Y410* probably null Het
Gm27013 T C 6: 130,676,915 Y528C probably damaging Het
Gm9992 T C 17: 7,369,682 N149S possibly damaging Het
Il23r T C 6: 67,423,696 H550R probably benign Het
Iqgap1 A T 7: 80,734,148 V1056E probably damaging Het
Lrit3 T A 3: 129,788,301 Y679F probably damaging Het
Megf8 A T 7: 25,341,706 E1120V probably damaging Het
Mta1 A G 12: 113,131,957 E518G probably damaging Het
Myo9a A G 9: 59,907,382 I2200M probably damaging Het
Ncoa7 T C 10: 30,722,729 H66R probably benign Het
Ncor1 A G 11: 62,340,545 V812A probably damaging Het
Ndnf T C 6: 65,703,666 Y310H possibly damaging Het
Ndst1 G A 18: 60,705,132 T347I probably benign Het
Olfr1229 A T 2: 89,282,953 F60Y probably benign Het
Olfr512 T C 7: 108,714,217 L276S probably damaging Het
Pcdhb10 C A 18: 37,413,169 Q433K probably benign Het
Pcdhb18 G A 18: 37,491,596 V660M possibly damaging Het
Pds5b T A 5: 150,723,353 N202K possibly damaging Het
Polk T C 13: 96,483,539 S718G probably benign Het
Ptpdc1 T C 13: 48,590,698 D149G probably damaging Het
Rb1cc1 T A 1: 6,249,193 C35* probably null Het
Samd9l C T 6: 3,376,156 M368I probably benign Het
Shroom3 T C 5: 92,962,248 M1739T probably damaging Het
Slc18a3 A G 14: 32,463,748 L226P probably damaging Het
Svil A T 18: 5,062,329 N392I probably benign Het
Syngr1 T A 15: 80,098,039 M9K probably benign Het
Taar2 T C 10: 23,941,032 S157P probably damaging Het
Tagap1 G T 17: 6,956,096 Y400* probably null Het
Tbc1d8 T A 1: 39,373,767 E976V probably damaging Het
Tmem163 G A 1: 127,491,552 probably benign Het
Tnfaip2 A G 12: 111,448,460 probably benign Het
Ttn C T 2: 76,706,517 S34988N possibly damaging Het
Tubg1 T G 11: 101,120,238 N15K probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zap70 T A 1: 36,781,365 V547D probably damaging Het
Zfp146 G T 7: 30,162,475 N47K probably benign Het
Znrf1 T G 8: 111,609,344 M159R probably benign Het
Other mutations in St7l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:St7l APN 3 104873579 splice site probably benign
IGL00919:St7l APN 3 104926466 missense probably damaging 1.00
IGL00945:St7l APN 3 104926482 missense probably damaging 0.96
IGL01644:St7l APN 3 104919456 nonsense probably null
IGL02158:St7l APN 3 104874832 missense possibly damaging 0.48
IGL02164:St7l APN 3 104922281 critical splice donor site probably null
IGL02331:St7l APN 3 104926588 missense probably damaging 0.98
IGL03220:St7l APN 3 104874823 splice site probably benign
R0118:St7l UTSW 3 104889303 missense probably damaging 0.97
R0320:St7l UTSW 3 104870913 nonsense probably null
R0345:St7l UTSW 3 104895809 splice site probably benign
R0714:St7l UTSW 3 104874928 missense probably benign 0.06
R0784:St7l UTSW 3 104870924 missense probably benign 0.13
R1664:St7l UTSW 3 104870898 missense probably damaging 1.00
R1719:St7l UTSW 3 104870987 missense probably benign 0.00
R1800:St7l UTSW 3 104919496 missense probably damaging 1.00
R1882:St7l UTSW 3 104868047 missense probably damaging 1.00
R3692:St7l UTSW 3 104891554 missense probably benign 0.27
R3879:St7l UTSW 3 104926447 missense probably damaging 1.00
R5130:St7l UTSW 3 104895764 missense probably damaging 1.00
R5887:St7l UTSW 3 104874928 missense probably benign 0.06
R6191:St7l UTSW 3 104868033 missense probably damaging 1.00
R6252:St7l UTSW 3 104919503 critical splice donor site probably null
R7307:St7l UTSW 3 104889353 missense probably benign 0.03
R7442:St7l UTSW 3 104889329 missense possibly damaging 0.93
R7860:St7l UTSW 3 104926577 missense probably benign 0.05
R8523:St7l UTSW 3 104868057 missense probably damaging 1.00
R8934:St7l UTSW 3 104889318 missense probably damaging 1.00
R8935:St7l UTSW 3 104870888 missense probably damaging 1.00
Z1177:St7l UTSW 3 104865309 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAGTCTCTGCTTGCTCCAGC -3'
(R):5'- AACATGGTATTTCTCAAACTTGTTTC -3'

Sequencing Primer
(F):5'- ATCTCTATGGTACTGGGCAGCAAC -3'
(R):5'- CTTGTTTCTAAGTAACTTTTTCCCAC -3'
Posted On 2016-07-06