Mutagenetix > Incidental Mutations

Incidental Mutation 'R5271:Lrit3'

400277

Institutional Source

Beutler Lab

Gene Symbol

Lrit3

Ensembl Gene

ENSMUSG00000093865

Gene Name

leucine-rich repeat, immunoglobulin-like and transmembrane domains 3

Synonyms

LOC242235

MMRRC Submission

042861-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5271 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

129787881-129804030 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 129788301 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 679 (Y679F)

Ref Sequence

ENSEMBL: ENSMUSP00000140184 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000179187] [ENSMUST00000185462]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000179187
AA Change: Y558F

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000136912
Gene: ENSMUSG00000093865
AA Change: Y558F

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LRRNT	20	61	2.7e-1	SMART
LRR	80	103	6.96e0	SMART
LRR	104	127	3.27e1	SMART
LRR_TYP	128	151	4.47e-3	SMART
LRR_TYP	152	175	7.37e-4	SMART
LRRCT	201	252	4.65e-2	SMART
Blast:IG	260	297	9e-13	BLAST
low complexity region	298	311	N/A	INTRINSIC
FN3	364	443	1.85e0	SMART
transmembrane domain	462	484	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000185462
AA Change: Y679F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000140184
Gene: ENSMUSG00000093865
AA Change: Y679F

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LRRNT	20	61	1.3e-3	SMART
LRR	80	103	2.9e-2	SMART
LRR	104	127	1.4e-1	SMART
LRR_TYP	128	151	1.9e-5	SMART
LRR_TYP	152	175	3.2e-6	SMART
LRRCT	201	252	2.3e-4	SMART
IGc2	266	335	4.7e-11	SMART
low complexity region	340	352	N/A	INTRINSIC
low complexity region	362	376	N/A	INTRINSIC
low complexity region	408	432	N/A	INTRINSIC
FN3	485	564	9e-3	SMART
transmembrane domain	583	605	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188978

Meta Mutation Damage Score

0.1444

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.6%
20x: 93.6%

Validation Efficiency

97% (65/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a fibronectin type III domain and a C-terminal transmembrane domain, as well as a leucine-rich repeat domain and immunoglobulin-like domain near the N-terminus. The encoded protein may regulate fibroblast growth factor receptors and affect the modification of these receptors, which are glycosylated differently in the Golgi and endoplasmic reticulum. Mutations in this gene are associated with congenital stationary night blindness, type 1F. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a targeted allele show a selective absence of the ERG b-wave with a normal a-wave component under scotopic conditions, as well as variable ERG responses with larger a-wave amplitudes, shorter b-wave amplitudes, and longer implicit times of both waves under photopic conditions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003H04Rik	T	C	3: 124,579,847	K33R	possibly damaging	Het
4632415L05Rik	C	T	3: 19,895,147		noncoding transcript	Het
4930542C16Rik	A	C	14: 24,615,530		noncoding transcript	Het
Adprh	A	T	16: 38,446,054	L242*	probably null	Het
Anapc1	G	A	2: 128,685,985	Q18*	probably null	Het
Bfar	T	C	16: 13,692,397		probably benign	Het
Bmp1	T	C	14: 70,508,128	I206V	probably benign	Het
Cc2d1b	T	A	4: 108,623,629		probably benign	Het
Clock	A	G	5: 76,241,954	I349T	probably damaging	Het
Cox11	A	G	11: 90,643,732	Y60C	probably damaging	Het
Cyp1a1	G	A	9: 57,702,838	V512M	probably benign	Het
Dcdc2a	T	C	13: 25,187,688	F311S	probably benign	Het
Dnase1l3	T	C	14: 7,993,843	D48G	probably damaging	Het
Engase	G	T	11: 118,481,397	A172S	probably damaging	Het
F2	T	C	2: 91,635,121		probably benign	Het
Gcc2	T	C	10: 58,269,695	V215A	possibly damaging	Het
Gm11677	C	T	11: 111,724,711		noncoding transcript	Het
Gm14548	A	T	7: 3,897,567	Y61*	probably null	Het
Gm20388	A	G	8: 122,271,133		probably benign	Het
Gm20671	T	C	5: 32,819,959	K1817R	possibly damaging	Het
Gm20939	T	A	17: 94,877,155	Y410*	probably null	Het
Gm27013	T	C	6: 130,676,915	Y528C	probably damaging	Het
Gm9992	T	C	17: 7,369,682	N149S	possibly damaging	Het
Il23r	T	C	6: 67,423,696	H550R	probably benign	Het
Iqgap1	A	T	7: 80,734,148	V1056E	probably damaging	Het
Megf8	A	T	7: 25,341,706	E1120V	probably damaging	Het
Mta1	A	G	12: 113,131,957	E518G	probably damaging	Het
Myo9a	A	G	9: 59,907,382	I2200M	probably damaging	Het
Ncoa7	T	C	10: 30,722,729	H66R	probably benign	Het
Ncor1	A	G	11: 62,340,545	V812A	probably damaging	Het
Ndnf	T	C	6: 65,703,666	Y310H	possibly damaging	Het
Ndst1	G	A	18: 60,705,132	T347I	probably benign	Het
Olfr1229	A	T	2: 89,282,953	F60Y	probably benign	Het
Olfr512	T	C	7: 108,714,217	L276S	probably damaging	Het
Pcdhb10	C	A	18: 37,413,169	Q433K	probably benign	Het
Pcdhb18	G	A	18: 37,491,596	V660M	possibly damaging	Het
Pds5b	T	A	5: 150,723,353	N202K	possibly damaging	Het
Polk	T	C	13: 96,483,539	S718G	probably benign	Het
Ptpdc1	T	C	13: 48,590,698	D149G	probably damaging	Het
Rb1cc1	T	A	1: 6,249,193	C35*	probably null	Het
Samd9l	C	T	6: 3,376,156	M368I	probably benign	Het
Shroom3	T	C	5: 92,962,248	M1739T	probably damaging	Het
Slc18a3	A	G	14: 32,463,748	L226P	probably damaging	Het
St7l	A	T	3: 104,868,060	Y84F	probably damaging	Het
Svil	A	T	18: 5,062,329	N392I	probably benign	Het
Syngr1	T	A	15: 80,098,039	M9K	probably benign	Het
Taar2	T	C	10: 23,941,032	S157P	probably damaging	Het
Tagap1	G	T	17: 6,956,096	Y400*	probably null	Het
Tbc1d8	T	A	1: 39,373,767	E976V	probably damaging	Het
Tmem163	G	A	1: 127,491,552		probably benign	Het
Tnfaip2	A	G	12: 111,448,460		probably benign	Het
Ttn	C	T	2: 76,706,517	S34988N	possibly damaging	Het
Tubg1	T	G	11: 101,120,238	N15K	probably damaging	Het
Vmn2r-ps159	G	T	4: 156,334,397		noncoding transcript	Het
Zap70	T	A	1: 36,781,365	V547D	probably damaging	Het
Zfp146	G	T	7: 30,162,475	N47K	probably benign	Het
Znrf1	T	G	8: 111,609,344	M159R	probably benign	Het

Other mutations in Lrit3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
FR4304:Lrit3	UTSW	3	129788819	small insertion	probably benign
FR4340:Lrit3	UTSW	3	129788808	small insertion	probably benign
FR4548:Lrit3	UTSW	3	129788813	small insertion	probably benign
FR4548:Lrit3	UTSW	3	129788816	small insertion	probably benign
FR4589:Lrit3	UTSW	3	129803913	frame shift	probably null
FR4737:Lrit3	UTSW	3	129788806	small insertion	probably benign
FR4737:Lrit3	UTSW	3	129788810	small insertion	probably benign
FR4737:Lrit3	UTSW	3	129803913	frame shift	probably null
FR4976:Lrit3	UTSW	3	129803910	unclassified	probably benign
R0555:Lrit3	UTSW	3	129791296	missense	probably damaging	1.00
R0629:Lrit3	UTSW	3	129788302	missense	probably damaging	1.00
R0631:Lrit3	UTSW	3	129788555	missense	probably damaging	1.00
R1690:Lrit3	UTSW	3	129800745	missense	probably damaging	0.99
R1902:Lrit3	UTSW	3	129791246	missense	probably benign	0.17
R1955:Lrit3	UTSW	3	129800481	missense	probably benign	0.11
R3155:Lrit3	UTSW	3	129791395	missense	probably benign	0.00
R4005:Lrit3	UTSW	3	129791372	missense	probably benign	0.14
R4445:Lrit3	UTSW	3	129788531	nonsense	probably null
R4675:Lrit3	UTSW	3	129788472	missense	probably damaging	1.00
R5104:Lrit3	UTSW	3	129788391	missense	possibly damaging	0.86
R5147:Lrit3	UTSW	3	129803925	missense	possibly damaging	0.78
R5505:Lrit3	UTSW	3	129791438	missense	possibly damaging	0.83
R5587:Lrit3	UTSW	3	129788898	missense	probably benign	0.25
R6056:Lrit3	UTSW	3	129789355	missense	probably damaging	1.00
R6239:Lrit3	UTSW	3	129800346	missense	probably damaging	0.98
R6280:Lrit3	UTSW	3	129788763	missense	probably damaging	0.99
R6305:Lrit3	UTSW	3	129800460	missense	probably damaging	0.98
R6441:Lrit3	UTSW	3	129800360	missense	probably benign
R6947:Lrit3	UTSW	3	129789234	missense	probably benign	0.01
R6949:Lrit3	UTSW	3	129789285	missense	probably damaging	1.00
R7850:Lrit3	UTSW	3	129800803	missense	probably damaging	1.00
R8157:Lrit3	UTSW	3	129800635	missense	probably benign	0.00
R8405:Lrit3	UTSW	3	129788652	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- ACAAATCGGGACCATTTGTTG -3'
(R):5'- AAATTGCAATGCACATCGGACC -3'

Sequencing Primer
(F):5'- CAAATCGGGACCATTTGTTGTTTTAG -3'
(R):5'- AATGCACATCGGACCCTTTCTG -3'

Posted On

2016-07-06