Incidental Mutation 'R5196:Fgd4'
ID400281
Institutional Source Beutler Lab
Gene Symbol Fgd4
Ensembl Gene ENSMUSG00000022788
Gene NameFYVE, RhoGEF and PH domain containing 4
SynonymsFrabin-alpha, 9330209B17Rik, ZFYVE6, Frabin-gamma, Frabin-beta, Frabin
MMRRC Submission 042772-MU
Accession Numbers

Genbank: NM_139232; MGI: 2183747

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5196 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location16416917-16600549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 16484142 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 183 (N183I)
Ref Sequence ENSEMBL: ENSMUSP00000125736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069284] [ENSMUST00000159542] [ENSMUST00000161188] [ENSMUST00000161861] [ENSMUST00000162671]
Predicted Effect probably benign
Transcript: ENSMUST00000069284
AA Change: N183I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000069573
Gene: ENSMUSG00000022788
AA Change: N183I

DomainStartEndE-ValueType
RhoGEF 210 392 1.48e-57 SMART
PH 423 523 1.91e-19 SMART
FYVE 551 620 2.2e-30 SMART
PH 644 742 1.31e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159058
Predicted Effect probably benign
Transcript: ENSMUST00000159542
AA Change: N183I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000125649
Gene: ENSMUSG00000022788
AA Change: N183I

DomainStartEndE-ValueType
RhoGEF 210 392 1.48e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161188
AA Change: N183I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000123763
Gene: ENSMUSG00000022788
AA Change: N183I

DomainStartEndE-ValueType
RhoGEF 210 392 1.48e-57 SMART
PH 423 523 1.91e-19 SMART
FYVE 551 603 1.94e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161624
Predicted Effect probably benign
Transcript: ENSMUST00000161861
AA Change: N183I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000125174
Gene: ENSMUSG00000022788
AA Change: N183I

DomainStartEndE-ValueType
RhoGEF 210 392 1.48e-57 SMART
PH 423 523 1.91e-19 SMART
FYVE 551 620 2.2e-30 SMART
PH 644 742 1.31e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162045
SMART Domains Protein: ENSMUSP00000125435
Gene: ENSMUSG00000022788

DomainStartEndE-ValueType
RhoGEF 210 392 1.48e-57 SMART
PH 423 504 2.36e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162124
SMART Domains Protein: ENSMUSP00000125165
Gene: ENSMUSG00000022788

DomainStartEndE-ValueType
RhoGEF 166 348 1.48e-57 SMART
PH 379 460 2.36e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162542
Predicted Effect probably benign
Transcript: ENSMUST00000162671
AA Change: N183I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000125736
Gene: ENSMUSG00000022788
AA Change: N183I

DomainStartEndE-ValueType
RhoGEF 210 392 1.48e-57 SMART
PH 423 523 1.91e-19 SMART
FYVE 551 620 2.2e-30 SMART
PH 644 742 1.31e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172181
SMART Domains Protein: ENSMUSP00000131870
Gene: ENSMUSG00000022788

DomainStartEndE-ValueType
RhoGEF 210 392 1.48e-57 SMART
PH 423 523 1.91e-19 SMART
FYVE 551 603 1.94e-8 SMART
Meta Mutation Damage Score 0.1866 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene is a member of the FYVE, RhoGEF and PH domain containing (FGD) family. The encoded protein is a Cdc42-specific guanine nucleotide exchange factor (GEF) that plays an essential role in regulating the actin cytoskeleton and cell morphology. Disruption of the gene in mouse causes abnormal nerve development and dysmyelination. Mutations in a similar gene in human can cause Charcot-Marie-Tooth disease type 4H (CMT4H), a disorder of the peripheral nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display dysmyelination in early peripheral nerve development, followed by severe myelin abnormalities, demyelinationn, nervous system electrophysiological deficits, and decreased grip strength at later stages. [provided by MGI curators]
Allele List at MGI

All alleles(60) : Gene trapped(60)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,796,438 T281A possibly damaging Het
4930503B20Rik A G 3: 146,646,263 probably benign Het
6330409D20Rik T A 2: 32,740,540 probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Amigo2 A G 15: 97,246,061 F160S probably damaging Het
Arcn1 A T 9: 44,760,027 L68M probably damaging Het
Arhgef25 A G 10: 127,185,109 S303P probably damaging Het
Asph A T 4: 9,607,830 S163T probably damaging Het
BC003331 T A 1: 150,382,389 D165V probably damaging Het
Birc6 T C 17: 74,606,141 probably benign Het
Ccm2 G A 11: 6,561,181 probably benign Het
Cdc42bpa T C 1: 180,072,413 V431A probably benign Het
Cdh7 T A 1: 110,138,000 M668K probably damaging Het
Cfap43 A T 19: 47,825,925 W157R probably damaging Het
Chrm5 T C 2: 112,480,384 Y129C probably damaging Het
Chrna5 A G 9: 55,006,519 I421V possibly damaging Het
Clk1 T A 1: 58,414,613 T301S probably benign Het
Col6a3 G T 1: 90,816,538 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam198a T G 9: 121,965,661 S294A probably benign Het
Fbxw19 T C 9: 109,484,428 Y234C probably benign Het
Fnip2 T C 3: 79,572,538 probably benign Het
Gm9847 T A 12: 14,495,015 noncoding transcript Het
H2-T23 A G 17: 36,032,607 probably null Het
Hdlbp T C 1: 93,420,193 E613G probably damaging Het
Kat6a G A 8: 22,911,713 R366H probably damaging Het
Kctd4 A G 14: 75,962,687 T33A probably benign Het
Klrb1c T A 6: 128,780,299 S268C probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrfip1 A G 1: 91,114,608 E245G probably damaging Het
Mast3 A T 8: 70,788,245 I220N probably damaging Het
Mfap3 A G 11: 57,529,813 T207A probably damaging Het
Mtdh G T 15: 34,118,004 K75N probably damaging Het
Mybpc1 A G 10: 88,536,351 Y806H probably damaging Het
Ntng1 T C 3: 109,934,983 D158G probably damaging Het
Olfr1176 A G 2: 88,339,748 Y61C possibly damaging Het
Olfr812 T A 10: 129,842,781 D87V possibly damaging Het
Pask A G 1: 93,310,083 probably benign Het
Pif1 G T 9: 65,588,092 A95S probably benign Het
Plppr2 T C 9: 21,941,132 F104S probably damaging Het
Prmt9 G A 8: 77,564,997 V333M probably benign Het
Pten A T 19: 32,815,497 M239L probably benign Het
Rb1cc1 A G 1: 6,234,230 D67G probably damaging Het
Reg2 T A 6: 78,405,547 L12* probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc5a7 C A 17: 54,281,722 probably null Het
Tcaf3 G T 6: 42,593,715 R368S probably benign Het
Tfcp2 A G 15: 100,520,714 V189A probably damaging Het
Uhrf1bp1 A G 17: 27,856,763 I5V probably benign Het
Wdr12 T C 1: 60,087,084 S191G probably damaging Het
Zfp536 G A 7: 37,480,760 R807W probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Fgd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Fgd4 APN 16 16484303 missense probably damaging 0.99
IGL01455:Fgd4 APN 16 16490490 missense probably benign 0.22
IGL02035:Fgd4 APN 16 16490416 splice site probably benign
IGL02353:Fgd4 APN 16 16462045 missense probably damaging 0.96
IGL02360:Fgd4 APN 16 16462045 missense probably damaging 0.96
IGL03100:Fgd4 APN 16 16477519 splice site probably benign
11287:Fgd4 UTSW 16 16423923 missense probably damaging 1.00
R0787:Fgd4 UTSW 16 16423901 splice site probably benign
R0853:Fgd4 UTSW 16 16474387 splice site probably benign
R0879:Fgd4 UTSW 16 16477449 missense probably damaging 1.00
R1482:Fgd4 UTSW 16 16484473 missense probably benign 0.39
R1619:Fgd4 UTSW 16 16424056 missense possibly damaging 0.52
R1635:Fgd4 UTSW 16 16475029 nonsense probably null
R2018:Fgd4 UTSW 16 16435960 missense probably benign 0.15
R2120:Fgd4 UTSW 16 16425828 missense probably benign 0.44
R2292:Fgd4 UTSW 16 16436000 missense possibly damaging 0.95
R2902:Fgd4 UTSW 16 16425865 missense probably damaging 1.00
R4575:Fgd4 UTSW 16 16437032 missense probably damaging 1.00
R4747:Fgd4 UTSW 16 16423929 missense probably damaging 1.00
R4941:Fgd4 UTSW 16 16484538 missense probably benign
R5372:Fgd4 UTSW 16 16484291 missense probably benign 0.03
R5457:Fgd4 UTSW 16 16462009 missense probably benign 0.39
R5486:Fgd4 UTSW 16 16475037 missense probably damaging 1.00
R6709:Fgd4 UTSW 16 16484481 missense probably benign 0.09
R6962:Fgd4 UTSW 16 16484087 splice site probably null
R7207:Fgd4 UTSW 16 16484556 missense probably benign 0.11
R7732:Fgd4 UTSW 16 16484595 missense probably benign
R7749:Fgd4 UTSW 16 16475154 missense probably benign 0.02
R7846:Fgd4 UTSW 16 16422726 missense probably damaging 1.00
R7929:Fgd4 UTSW 16 16422726 missense probably damaging 1.00
Z1088:Fgd4 UTSW 16 16484470 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATTAGCCTCCAAGCTTGCAAATG -3'
(R):5'- ACTACTCTTAGCCCAGAGATGG -3'

Sequencing Primer
(F):5'- CAAGCTTGCAAATGGTTTCTCTG -3'
(R):5'- CTCCTGATACACATGTGCTGAATGG -3'
Posted On2016-07-06