Mutagenetix > Incidental Mutation

Incidental Mutation 'R5196:Uhrf1bp1'

400282

Institutional Source

Beutler Lab

Gene Symbol

Uhrf1bp1

Ensembl Gene

ENSMUSG00000039512

Gene Name

UHRF1 (ICBP90) binding protein 1

Synonyms

1110020K19Rik, F830021D11Rik

MMRRC Submission

042772-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5196 (G1)

Quality Score

140

Status

Validated

Chromosome

Chromosomal Location

27856490-27900040 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 27856763 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 5 (I5V)

Ref Sequence

ENSEMBL: ENSMUSP00000110499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071006] [ENSMUST00000114849]

AlphaFold

B2KF50

Predicted Effect

probably benign
Transcript: ENSMUST00000071006

SMART Domains

Protein: ENSMUSP00000063976
Gene: ENSMUSG00000024217

Domain	Start	End	E-Value	Type
ZnF_U1	1	37	5.13e-15	SMART
low complexity region	63	152	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114849
AA Change: I5V

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000110499
Gene: ENSMUSG00000039512
AA Change: I5V

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	1	104	2.6e-18	PFAM
low complexity region	234	247	N/A	INTRINSIC
low complexity region	297	306	N/A	INTRINSIC
low complexity region	1128	1144	N/A	INTRINSIC
low complexity region	1200	1216	N/A	INTRINSIC
low complexity region	1322	1333	N/A	INTRINSIC
low complexity region	1375	1386	N/A	INTRINSIC
coiled coil region	1394	1424	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130810

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137581

Meta Mutation Damage Score

0.0795

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

100% (62/62)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001O22Rik	T	C	2: 30,796,438	T281A	possibly damaging	Het
4930503B20Rik	A	G	3: 146,646,263		probably benign	Het
6330409D20Rik	T	A	2: 32,740,540		probably benign	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Amigo2	A	G	15: 97,246,061	F160S	probably damaging	Het
Arcn1	A	T	9: 44,760,027	L68M	probably damaging	Het
Arhgef25	A	G	10: 127,185,109	S303P	probably damaging	Het
Asph	A	T	4: 9,607,830	S163T	probably damaging	Het
BC003331	T	A	1: 150,382,389	D165V	probably damaging	Het
Birc6	T	C	17: 74,606,141		probably benign	Het
Ccm2	G	A	11: 6,561,181		probably benign	Het
Cdc42bpa	T	C	1: 180,072,413	V431A	probably benign	Het
Cdh7	T	A	1: 110,138,000	M668K	probably damaging	Het
Cfap43	A	T	19: 47,825,925	W157R	probably damaging	Het
Chrm5	T	C	2: 112,480,384	Y129C	probably damaging	Het
Chrna5	A	G	9: 55,006,519	I421V	possibly damaging	Het
Clk1	T	A	1: 58,414,613	T301S	probably benign	Het
Col6a3	G	T	1: 90,816,538		probably null	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fam198a	T	G	9: 121,965,661	S294A	probably benign	Het
Fbxw19	T	C	9: 109,484,428	Y234C	probably benign	Het
Fgd4	T	A	16: 16,484,142	N183I	probably benign	Het
Fnip2	T	C	3: 79,572,538		probably benign	Het
Gm9847	T	A	12: 14,495,015		noncoding transcript	Het
H2-T23	A	G	17: 36,032,607		probably null	Het
Hdlbp	T	C	1: 93,420,193	E613G	probably damaging	Het
Kat6a	G	A	8: 22,911,713	R366H	probably damaging	Het
Kctd4	A	G	14: 75,962,687	T33A	probably benign	Het
Klrb1c	T	A	6: 128,780,299	S268C	probably benign	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lrrfip1	A	G	1: 91,114,608	E245G	probably damaging	Het
Mast3	A	T	8: 70,788,245	I220N	probably damaging	Het
Mfap3	A	G	11: 57,529,813	T207A	probably damaging	Het
Mtdh	G	T	15: 34,118,004	K75N	probably damaging	Het
Mybpc1	A	G	10: 88,536,351	Y806H	probably damaging	Het
Ntng1	T	C	3: 109,934,983	D158G	probably damaging	Het
Olfr1176	A	G	2: 88,339,748	Y61C	possibly damaging	Het
Olfr812	T	A	10: 129,842,781	D87V	possibly damaging	Het
Pask	A	G	1: 93,310,083		probably benign	Het
Pif1	G	T	9: 65,588,092	A95S	probably benign	Het
Plppr2	T	C	9: 21,941,132	F104S	probably damaging	Het
Prmt9	G	A	8: 77,564,997	V333M	probably benign	Het
Pten	A	T	19: 32,815,497	M239L	probably benign	Het
Rb1cc1	A	G	1: 6,234,230	D67G	probably damaging	Het
Reg2	T	A	6: 78,405,547	L12*	probably null	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Slc5a7	C	A	17: 54,281,722		probably null	Het
Tcaf3	G	T	6: 42,593,715	R368S	probably benign	Het
Tfcp2	A	G	15: 100,520,714	V189A	probably damaging	Het
Wdr12	T	C	1: 60,087,084	S191G	probably damaging	Het
Zfp536	G	A	7: 37,480,760	R807W	probably damaging	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het

Other mutations in Uhrf1bp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00675:Uhrf1bp1	APN	17	27876917	splice site	probably benign
IGL00786:Uhrf1bp1	APN	17	27879292	missense	probably damaging	0.99
IGL01074:Uhrf1bp1	APN	17	27879291	missense	possibly damaging	0.94
IGL01780:Uhrf1bp1	APN	17	27893500	missense	probably damaging	1.00
IGL02668:Uhrf1bp1	APN	17	27886575	missense	possibly damaging	0.53
IGL02686:Uhrf1bp1	APN	17	27894589	missense	probably benign
IGL03240:Uhrf1bp1	APN	17	27893253	missense	probably benign	0.37
hades	UTSW	17	27894746	missense	probably damaging	1.00
R0167:Uhrf1bp1	UTSW	17	27880202	missense	possibly damaging	0.46
R0240:Uhrf1bp1	UTSW	17	27895870	splice site	probably benign
R0332:Uhrf1bp1	UTSW	17	27893294	critical splice donor site	probably null
R0668:Uhrf1bp1	UTSW	17	27895939	missense	probably benign	0.16
R0726:Uhrf1bp1	UTSW	17	27885489	missense	possibly damaging	0.50
R0964:Uhrf1bp1	UTSW	17	27887178	missense	probably damaging	0.96
R1125:Uhrf1bp1	UTSW	17	27893449	missense	probably damaging	1.00
R1139:Uhrf1bp1	UTSW	17	27890071	missense	possibly damaging	0.87
R1164:Uhrf1bp1	UTSW	17	27895380	critical splice donor site	probably null
R1192:Uhrf1bp1	UTSW	17	27890071	missense	possibly damaging	0.87
R1277:Uhrf1bp1	UTSW	17	27890071	missense	possibly damaging	0.87
R1279:Uhrf1bp1	UTSW	17	27890071	missense	possibly damaging	0.87
R1340:Uhrf1bp1	UTSW	17	27894721	missense	probably benign	0.00
R1341:Uhrf1bp1	UTSW	17	27877419	splice site	probably benign
R1344:Uhrf1bp1	UTSW	17	27894577	missense	probably benign	0.41
R1418:Uhrf1bp1	UTSW	17	27894577	missense	probably benign	0.41
R1552:Uhrf1bp1	UTSW	17	27890071	missense	possibly damaging	0.87
R1726:Uhrf1bp1	UTSW	17	27886251	splice site	probably null
R1791:Uhrf1bp1	UTSW	17	27894746	missense	probably damaging	1.00
R1796:Uhrf1bp1	UTSW	17	27890071	missense	possibly damaging	0.87
R2858:Uhrf1bp1	UTSW	17	27885462	missense	probably damaging	0.99
R3034:Uhrf1bp1	UTSW	17	27894746	missense	probably damaging	1.00
R4111:Uhrf1bp1	UTSW	17	27886090	nonsense	probably null
R4159:Uhrf1bp1	UTSW	17	27884087	missense	probably damaging	1.00
R4160:Uhrf1bp1	UTSW	17	27884087	missense	probably damaging	1.00
R4161:Uhrf1bp1	UTSW	17	27884087	missense	probably damaging	1.00
R4431:Uhrf1bp1	UTSW	17	27885931	missense	probably damaging	1.00
R4575:Uhrf1bp1	UTSW	17	27887503	missense	probably benign	0.02
R4657:Uhrf1bp1	UTSW	17	27890105	missense	probably benign	0.09
R4666:Uhrf1bp1	UTSW	17	27893503	missense	possibly damaging	0.95
R4825:Uhrf1bp1	UTSW	17	27877394	missense	probably damaging	0.98
R4872:Uhrf1bp1	UTSW	17	27890136	missense	probably benign	0.10
R4956:Uhrf1bp1	UTSW	17	27889984	splice site	probably null
R4976:Uhrf1bp1	UTSW	17	27884026	missense	probably damaging	0.99
R4982:Uhrf1bp1	UTSW	17	27886606	missense	probably benign	0.05
R5017:Uhrf1bp1	UTSW	17	27894739	nonsense	probably null
R5033:Uhrf1bp1	UTSW	17	27886864	missense	probably damaging	0.99
R5137:Uhrf1bp1	UTSW	17	27876990	splice site	probably null
R5159:Uhrf1bp1	UTSW	17	27881556	missense	probably damaging	0.98
R5177:Uhrf1bp1	UTSW	17	27885018	missense	possibly damaging	0.94
R5214:Uhrf1bp1	UTSW	17	27887515	missense	probably benign
R5352:Uhrf1bp1	UTSW	17	27887515	missense	probably benign
R5354:Uhrf1bp1	UTSW	17	27887515	missense	probably benign
R5425:Uhrf1bp1	UTSW	17	27887515	missense	probably benign
R5601:Uhrf1bp1	UTSW	17	27884494	missense	probably damaging	1.00
R6080:Uhrf1bp1	UTSW	17	27880297	missense	probably benign
R6088:Uhrf1bp1	UTSW	17	27884605	critical splice donor site	probably null
R6331:Uhrf1bp1	UTSW	17	27893201	missense	probably benign	0.01
R6529:Uhrf1bp1	UTSW	17	27879776	missense	possibly damaging	0.90
R6614:Uhrf1bp1	UTSW	17	27876925	missense	probably benign	0.18
R6701:Uhrf1bp1	UTSW	17	27887357	nonsense	probably null
R7082:Uhrf1bp1	UTSW	17	27890065	missense	probably damaging	1.00
R7158:Uhrf1bp1	UTSW	17	27886433	nonsense	probably null
R8338:Uhrf1bp1	UTSW	17	27876695	missense	probably damaging	1.00
R8914:Uhrf1bp1	UTSW	17	27886913	missense	possibly damaging	0.66
R9135:Uhrf1bp1	UTSW	17	27885928	nonsense	probably null
R9218:Uhrf1bp1	UTSW	17	27895555	missense	probably benign	0.00
R9421:Uhrf1bp1	UTSW	17	27876686	missense	probably damaging	1.00
R9495:Uhrf1bp1	UTSW	17	27893440	missense	probably damaging	1.00
R9514:Uhrf1bp1	UTSW	17	27893440	missense	probably damaging	1.00
R9621:Uhrf1bp1	UTSW	17	27886779	missense	probably benign	0.00
R9766:Uhrf1bp1	UTSW	17	27886825	missense	probably damaging	1.00
RF005:Uhrf1bp1	UTSW	17	27885531	missense	probably damaging	1.00
X0017:Uhrf1bp1	UTSW	17	27877341	missense	probably benign	0.03
Z1176:Uhrf1bp1	UTSW	17	27876676	missense	probably damaging	1.00
Z1176:Uhrf1bp1	UTSW	17	27886306	missense	probably damaging	1.00
Z1177:Uhrf1bp1	UTSW	17	27884966	missense	not run

Predicted Primers

PCR Primer
(F):5'- AACTCCTGGCGCTGAGTTAG -3'
(R):5'- TTTTCAAGAGTGATGCAACAGGGTC -3'

Sequencing Primer
(F):5'- GCTGAGTTAGGGGCGACAG -3'
(R):5'- AGGAGCTCGCCTCACAGAAG -3'

Posted On

2016-07-06