Incidental Mutation 'R5196:Afg3l2'
ID 400288
Institutional Source Beutler Lab
Gene Symbol Afg3l2
Ensembl Gene ENSMUSG00000024527
Gene Name AFG3-like AAA ATPase 2
Synonyms Emv66, 2310036I02Rik, par
MMRRC Submission 042772-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5196 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 67537834-67582242 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 67554329 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Methionine at position 458 (L458M)
Ref Sequence ENSEMBL: ENSMUSP00000025408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025408]
AlphaFold Q8JZQ2
Predicted Effect probably damaging
Transcript: ENSMUST00000025408
AA Change: L458M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: L458M

DomainStartEndE-ValueType
low complexity region 95 121 N/A INTRINSIC
Pfam:FtsH_ext 144 241 8.8e-12 PFAM
transmembrane domain 251 270 N/A INTRINSIC
low complexity region 271 286 N/A INTRINSIC
AAA 339 478 1.37e-23 SMART
Pfam:Peptidase_M41 540 743 4e-77 PFAM
low complexity region 780 794 N/A INTRINSIC
Meta Mutation Damage Score 0.3865 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,686,450 (GRCm39) T281A possibly damaging Het
4930503B20Rik A G 3: 146,352,018 (GRCm39) probably benign Het
6330409D20Rik T A 2: 32,630,552 (GRCm39) probably benign Het
Amigo2 A G 15: 97,143,942 (GRCm39) F160S probably damaging Het
Arcn1 A T 9: 44,671,324 (GRCm39) L68M probably damaging Het
Arhgef25 A G 10: 127,020,978 (GRCm39) S303P probably damaging Het
Asph A T 4: 9,607,830 (GRCm39) S163T probably damaging Het
Birc6 T C 17: 74,913,136 (GRCm39) probably benign Het
Bltp3a A G 17: 28,075,737 (GRCm39) I5V probably benign Het
Ccm2 G A 11: 6,511,181 (GRCm39) probably benign Het
Cdc42bpa T C 1: 179,899,978 (GRCm39) V431A probably benign Het
Cdh20 T A 1: 110,065,730 (GRCm39) M668K probably damaging Het
Cfap43 A T 19: 47,814,364 (GRCm39) W157R probably damaging Het
Chrm5 T C 2: 112,310,729 (GRCm39) Y129C probably damaging Het
Chrna5 A G 9: 54,913,803 (GRCm39) I421V possibly damaging Het
Clk1 T A 1: 58,453,772 (GRCm39) T301S probably benign Het
Col6a3 G T 1: 90,744,260 (GRCm39) probably null Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Fbxw19 T C 9: 109,313,496 (GRCm39) Y234C probably benign Het
Fgd4 T A 16: 16,302,006 (GRCm39) N183I probably benign Het
Fnip2 T C 3: 79,479,845 (GRCm39) probably benign Het
Gask1a T G 9: 121,794,727 (GRCm39) S294A probably benign Het
Gm9847 T A 12: 14,545,016 (GRCm39) noncoding transcript Het
H2-T23 A G 17: 36,343,499 (GRCm39) probably null Het
Hdlbp T C 1: 93,347,915 (GRCm39) E613G probably damaging Het
Kat6a G A 8: 23,401,729 (GRCm39) R366H probably damaging Het
Kctd4 A G 14: 76,200,127 (GRCm39) T33A probably benign Het
Klrb1c T A 6: 128,757,262 (GRCm39) S268C probably benign Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Lrrfip1 A G 1: 91,042,330 (GRCm39) E245G probably damaging Het
Mast3 A T 8: 71,240,889 (GRCm39) I220N probably damaging Het
Mfap3 A G 11: 57,420,639 (GRCm39) T207A probably damaging Het
Mtdh G T 15: 34,118,150 (GRCm39) K75N probably damaging Het
Mybpc1 A G 10: 88,372,213 (GRCm39) Y806H probably damaging Het
Ntng1 T C 3: 109,842,299 (GRCm39) D158G probably damaging Het
Odr4 T A 1: 150,258,140 (GRCm39) D165V probably damaging Het
Or5d46 A G 2: 88,170,092 (GRCm39) Y61C possibly damaging Het
Or6c216 T A 10: 129,678,650 (GRCm39) D87V possibly damaging Het
Pask A G 1: 93,237,805 (GRCm39) probably benign Het
Pif1 G T 9: 65,495,374 (GRCm39) A95S probably benign Het
Plppr2 T C 9: 21,852,428 (GRCm39) F104S probably damaging Het
Prmt9 G A 8: 78,291,626 (GRCm39) V333M probably benign Het
Pten A T 19: 32,792,897 (GRCm39) M239L probably benign Het
Rb1cc1 A G 1: 6,304,454 (GRCm39) D67G probably damaging Het
Reg2 T A 6: 78,382,530 (GRCm39) L12* probably null Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Slc5a7 C A 17: 54,588,750 (GRCm39) probably null Het
Tcaf3 G T 6: 42,570,649 (GRCm39) R368S probably benign Het
Tfcp2 A G 15: 100,418,595 (GRCm39) V189A probably damaging Het
Wdr12 T C 1: 60,126,243 (GRCm39) S191G probably damaging Het
Zfp536 G A 7: 37,180,185 (GRCm39) R807W probably damaging Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Other mutations in Afg3l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00962:Afg3l2 APN 18 67,564,723 (GRCm39) critical splice donor site probably null
IGL01395:Afg3l2 APN 18 67,575,880 (GRCm39) missense probably benign 0.21
IGL01533:Afg3l2 APN 18 67,538,488 (GRCm39) nonsense probably null
IGL01814:Afg3l2 APN 18 67,538,544 (GRCm39) missense probably benign 0.23
IGL01868:Afg3l2 APN 18 67,547,218 (GRCm39) missense possibly damaging 0.83
IGL02399:Afg3l2 APN 18 67,562,110 (GRCm39) missense possibly damaging 0.82
IGL02827:Afg3l2 APN 18 67,559,015 (GRCm39) missense probably damaging 1.00
IGL03342:Afg3l2 APN 18 67,540,390 (GRCm39) missense probably benign
IGL03392:Afg3l2 APN 18 67,547,139 (GRCm39) splice site probably benign
radicle UTSW 18 67,556,023 (GRCm39) missense probably damaging 1.00
rootlet UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R0057:Afg3l2 UTSW 18 67,556,156 (GRCm39) missense probably damaging 1.00
R0107:Afg3l2 UTSW 18 67,564,836 (GRCm39) missense probably damaging 1.00
R0650:Afg3l2 UTSW 18 67,548,627 (GRCm39) missense possibly damaging 0.77
R0831:Afg3l2 UTSW 18 67,554,297 (GRCm39) missense probably damaging 1.00
R0899:Afg3l2 UTSW 18 67,556,047 (GRCm39) missense possibly damaging 0.65
R0962:Afg3l2 UTSW 18 67,538,497 (GRCm39) missense possibly damaging 0.77
R1672:Afg3l2 UTSW 18 67,540,493 (GRCm39) missense probably benign 0.31
R1815:Afg3l2 UTSW 18 67,548,643 (GRCm39) nonsense probably null
R1838:Afg3l2 UTSW 18 67,547,242 (GRCm39) missense probably damaging 0.99
R2013:Afg3l2 UTSW 18 67,564,842 (GRCm39) missense probably damaging 0.99
R2383:Afg3l2 UTSW 18 67,556,026 (GRCm39) missense possibly damaging 0.91
R2906:Afg3l2 UTSW 18 67,573,292 (GRCm39) missense probably damaging 1.00
R4763:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R4765:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R4775:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R5193:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R5197:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R5257:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R5361:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R5362:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R5363:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R5397:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R5588:Afg3l2 UTSW 18 67,573,277 (GRCm39) missense possibly damaging 0.88
R5605:Afg3l2 UTSW 18 67,575,425 (GRCm39) nonsense probably null
R5696:Afg3l2 UTSW 18 67,540,529 (GRCm39) missense probably damaging 1.00
R5722:Afg3l2 UTSW 18 67,573,269 (GRCm39) missense probably benign 0.44
R5779:Afg3l2 UTSW 18 67,573,513 (GRCm39) missense probably null 0.12
R5972:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R5973:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R5974:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R5979:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R5994:Afg3l2 UTSW 18 67,562,140 (GRCm39) missense probably damaging 1.00
R6026:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6027:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6028:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6029:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6075:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6077:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6081:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6131:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6132:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6134:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6152:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6154:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6169:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6178:Afg3l2 UTSW 18 67,542,598 (GRCm39) missense possibly damaging 0.91
R6187:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6216:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6718:Afg3l2 UTSW 18 67,554,346 (GRCm39) missense probably damaging 1.00
R7388:Afg3l2 UTSW 18 67,556,023 (GRCm39) missense probably damaging 1.00
R8479:Afg3l2 UTSW 18 67,581,986 (GRCm39) missense probably benign 0.05
R8531:Afg3l2 UTSW 18 67,540,439 (GRCm39) missense probably damaging 0.99
R9017:Afg3l2 UTSW 18 67,542,550 (GRCm39) missense possibly damaging 0.81
R9220:Afg3l2 UTSW 18 67,562,266 (GRCm39) missense probably benign
R9222:Afg3l2 UTSW 18 67,567,257 (GRCm39) missense probably benign 0.05
R9371:Afg3l2 UTSW 18 67,567,262 (GRCm39) missense possibly damaging 0.84
R9381:Afg3l2 UTSW 18 67,575,451 (GRCm39) missense probably damaging 1.00
R9562:Afg3l2 UTSW 18 67,554,365 (GRCm39) missense probably damaging 1.00
Z1176:Afg3l2 UTSW 18 67,564,777 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GGCACTGTCCAGCTTCAATG -3'
(R):5'- AGTTTACATCTTGATTGTAGCTCCC -3'

Sequencing Primer
(F):5'- TCCAGCTTCAATGGTCGAAG -3'
(R):5'- GATTGTAGCTCCCCTCTCCAG -3'
Posted On 2016-07-06