Mutagenetix > Incidental Mutation

Incidental Mutation 'R5196:Afg3l2'

400288

Institutional Source

Beutler Lab

Gene Symbol

Afg3l2

Ensembl Gene

ENSMUSG00000024527

Gene Name

AFG3-like AAA ATPase 2

Synonyms

2310036I02Rik, Emv66, par

MMRRC Submission

042772-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5196 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

67404767-67449166 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 67421259 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Methionine at position 458 (L458M)

Ref Sequence

ENSEMBL: ENSMUSP00000025408 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025408]

AlphaFold

Q8JZQ2

Predicted Effect

probably damaging
Transcript: ENSMUST00000025408
AA Change: L458M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: L458M

Domain	Start	End	E-Value	Type
low complexity region	95	121	N/A	INTRINSIC
Pfam:FtsH_ext	144	241	8.8e-12	PFAM
transmembrane domain	251	270	N/A	INTRINSIC
low complexity region	271	286	N/A	INTRINSIC
AAA	339	478	1.37e-23	SMART
Pfam:Peptidase_M41	540	743	4e-77	PFAM
low complexity region	780	794	N/A	INTRINSIC

Meta Mutation Damage Score

0.3865

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001O22Rik	T	C	2: 30,796,438	T281A	possibly damaging	Het
4930503B20Rik	A	G	3: 146,646,263		probably benign	Het
6330409D20Rik	T	A	2: 32,740,540		probably benign	Het
Amigo2	A	G	15: 97,246,061	F160S	probably damaging	Het
Arcn1	A	T	9: 44,760,027	L68M	probably damaging	Het
Arhgef25	A	G	10: 127,185,109	S303P	probably damaging	Het
Asph	A	T	4: 9,607,830	S163T	probably damaging	Het
BC003331	T	A	1: 150,382,389	D165V	probably damaging	Het
Birc6	T	C	17: 74,606,141		probably benign	Het
Ccm2	G	A	11: 6,561,181		probably benign	Het
Cdc42bpa	T	C	1: 180,072,413	V431A	probably benign	Het
Cdh7	T	A	1: 110,138,000	M668K	probably damaging	Het
Cfap43	A	T	19: 47,825,925	W157R	probably damaging	Het
Chrm5	T	C	2: 112,480,384	Y129C	probably damaging	Het
Chrna5	A	G	9: 55,006,519	I421V	possibly damaging	Het
Clk1	T	A	1: 58,414,613	T301S	probably benign	Het
Col6a3	G	T	1: 90,816,538		probably null	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fam198a	T	G	9: 121,965,661	S294A	probably benign	Het
Fbxw19	T	C	9: 109,484,428	Y234C	probably benign	Het
Fgd4	T	A	16: 16,484,142	N183I	probably benign	Het
Fnip2	T	C	3: 79,572,538		probably benign	Het
Gm9847	T	A	12: 14,495,015		noncoding transcript	Het
H2-T23	A	G	17: 36,032,607		probably null	Het
Hdlbp	T	C	1: 93,420,193	E613G	probably damaging	Het
Kat6a	G	A	8: 22,911,713	R366H	probably damaging	Het
Kctd4	A	G	14: 75,962,687	T33A	probably benign	Het
Klrb1c	T	A	6: 128,780,299	S268C	probably benign	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lrrfip1	A	G	1: 91,114,608	E245G	probably damaging	Het
Mast3	A	T	8: 70,788,245	I220N	probably damaging	Het
Mfap3	A	G	11: 57,529,813	T207A	probably damaging	Het
Mtdh	G	T	15: 34,118,004	K75N	probably damaging	Het
Mybpc1	A	G	10: 88,536,351	Y806H	probably damaging	Het
Ntng1	T	C	3: 109,934,983	D158G	probably damaging	Het
Olfr1176	A	G	2: 88,339,748	Y61C	possibly damaging	Het
Olfr812	T	A	10: 129,842,781	D87V	possibly damaging	Het
Pask	A	G	1: 93,310,083		probably benign	Het
Pif1	G	T	9: 65,588,092	A95S	probably benign	Het
Plppr2	T	C	9: 21,941,132	F104S	probably damaging	Het
Prmt9	G	A	8: 77,564,997	V333M	probably benign	Het
Pten	A	T	19: 32,815,497	M239L	probably benign	Het
Rb1cc1	A	G	1: 6,234,230	D67G	probably damaging	Het
Reg2	T	A	6: 78,405,547	L12*	probably null	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Slc5a7	C	A	17: 54,281,722		probably null	Het
Tcaf3	G	T	6: 42,593,715	R368S	probably benign	Het
Tfcp2	A	G	15: 100,520,714	V189A	probably damaging	Het
Uhrf1bp1	A	G	17: 27,856,763	I5V	probably benign	Het
Wdr12	T	C	1: 60,087,084	S191G	probably damaging	Het
Zfp536	G	A	7: 37,480,760	R807W	probably damaging	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het

Other mutations in Afg3l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00962:Afg3l2	APN	18	67431653	critical splice donor site	probably null
IGL01395:Afg3l2	APN	18	67442810	missense	probably benign	0.21
IGL01533:Afg3l2	APN	18	67405418	nonsense	probably null
IGL01814:Afg3l2	APN	18	67405474	missense	probably benign	0.23
IGL01868:Afg3l2	APN	18	67414148	missense	possibly damaging	0.83
IGL02399:Afg3l2	APN	18	67429040	missense	possibly damaging	0.82
IGL02827:Afg3l2	APN	18	67425945	missense	probably damaging	1.00
IGL03342:Afg3l2	APN	18	67407320	missense	probably benign
IGL03392:Afg3l2	APN	18	67414069	splice site	probably benign
radicle	UTSW	18	67422953	missense	probably damaging	1.00
rootlet	UTSW	18	67421259	missense	probably damaging	1.00
R0057:Afg3l2	UTSW	18	67423086	missense	probably damaging	1.00
R0107:Afg3l2	UTSW	18	67431766	missense	probably damaging	1.00
R0650:Afg3l2	UTSW	18	67415557	missense	possibly damaging	0.77
R0831:Afg3l2	UTSW	18	67421227	missense	probably damaging	1.00
R0899:Afg3l2	UTSW	18	67422977	missense	possibly damaging	0.65
R0962:Afg3l2	UTSW	18	67405427	missense	possibly damaging	0.77
R1672:Afg3l2	UTSW	18	67407423	missense	probably benign	0.31
R1815:Afg3l2	UTSW	18	67415573	nonsense	probably null
R1838:Afg3l2	UTSW	18	67414172	missense	probably damaging	0.99
R2013:Afg3l2	UTSW	18	67431772	missense	probably damaging	0.99
R2383:Afg3l2	UTSW	18	67422956	missense	possibly damaging	0.91
R2906:Afg3l2	UTSW	18	67440222	missense	probably damaging	1.00
R4763:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R4765:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R4775:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5193:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5197:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5257:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5361:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5362:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5363:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5397:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5588:Afg3l2	UTSW	18	67440207	missense	possibly damaging	0.88
R5605:Afg3l2	UTSW	18	67442355	nonsense	probably null
R5696:Afg3l2	UTSW	18	67407459	missense	probably damaging	1.00
R5722:Afg3l2	UTSW	18	67440199	missense	probably benign	0.44
R5779:Afg3l2	UTSW	18	67440443	missense	probably null	0.12
R5972:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5973:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5974:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5979:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5994:Afg3l2	UTSW	18	67429070	missense	probably damaging	1.00
R6026:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6027:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6028:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6029:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6033:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6033:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6035:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6035:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6075:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6077:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6081:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6131:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6132:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6134:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6152:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6154:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6169:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6178:Afg3l2	UTSW	18	67409528	missense	possibly damaging	0.91
R6187:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6216:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6718:Afg3l2	UTSW	18	67421276	missense	probably damaging	1.00
R7388:Afg3l2	UTSW	18	67422953	missense	probably damaging	1.00
R8479:Afg3l2	UTSW	18	67448916	missense	probably benign	0.05
R8531:Afg3l2	UTSW	18	67407369	missense	probably damaging	0.99
R9017:Afg3l2	UTSW	18	67409480	missense	possibly damaging	0.81
R9220:Afg3l2	UTSW	18	67429196	missense	probably benign
R9222:Afg3l2	UTSW	18	67434187	missense	probably benign	0.05
R9371:Afg3l2	UTSW	18	67434192	missense	possibly damaging	0.84
R9381:Afg3l2	UTSW	18	67442381	missense	probably damaging	1.00
R9562:Afg3l2	UTSW	18	67421295	missense	probably damaging	1.00
Z1176:Afg3l2	UTSW	18	67431707	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- GGCACTGTCCAGCTTCAATG -3'
(R):5'- AGTTTACATCTTGATTGTAGCTCCC -3'

Sequencing Primer
(F):5'- TCCAGCTTCAATGGTCGAAG -3'
(R):5'- GATTGTAGCTCCCCTCTCCAG -3'

Posted On

2016-07-06