Mutagenetix > Incidental Mutation

Incidental Mutation 'R5271:Samd9l'

400293

Institutional Source

Beutler Lab

Gene Symbol

Samd9l

Ensembl Gene

ENSMUSG00000047735

Gene Name

sterile alpha motif domain containing 9-like

Synonyms

ESTM25

MMRRC Submission

042861-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5271 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3372257-3399572 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 3376156 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 368 (M368I)

Ref Sequence

ENSEMBL: ENSMUSP00000112688 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000120087] [ENSMUST00000201638]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000120087
AA Change: M368I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000112688
Gene: ENSMUSG00000047735
AA Change: M368I

Domain	Start	End	E-Value	Type
SCOP:d1kw4a_	8	75	4e-8	SMART
Blast:SAM	11	75	1e-30	BLAST
low complexity region	96	115	N/A	INTRINSIC
low complexity region	385	397	N/A	INTRINSIC
low complexity region	530	541	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201638

SMART Domains

Protein: ENSMUSP00000144632
Gene: ENSMUSG00000047735

Domain	Start	End	E-Value	Type
Pfam:Ste50p-SAM	10	80	1.2e-8	PFAM
Pfam:SAM_2	11	68	8.7e-6	PFAM
Pfam:SAM_1	12	71	2.5e-7	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.6%
20x: 93.6%

Validation Efficiency

97% (65/67)

MGI Phenotype

PHENOTYPE: Mice that are either heterozygous or homozygous for a reporter allele develop myeloid diseases and acute myelogenous leukemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003H04Rik	T	C	3: 124,579,847	K33R	possibly damaging	Het
4632415L05Rik	C	T	3: 19,895,147		noncoding transcript	Het
4930542C16Rik	A	C	14: 24,615,530		noncoding transcript	Het
Adprh	A	T	16: 38,446,054	L242*	probably null	Het
Anapc1	G	A	2: 128,685,985	Q18*	probably null	Het
Bfar	T	C	16: 13,692,397		probably benign	Het
Bmp1	T	C	14: 70,508,128	I206V	probably benign	Het
Cc2d1b	T	A	4: 108,623,629		probably benign	Het
Clock	A	G	5: 76,241,954	I349T	probably damaging	Het
Cox11	A	G	11: 90,643,732	Y60C	probably damaging	Het
Cyp1a1	G	A	9: 57,702,838	V512M	probably benign	Het
Dcdc2a	T	C	13: 25,187,688	F311S	probably benign	Het
Dnase1l3	T	C	14: 7,993,843	D48G	probably damaging	Het
Engase	G	T	11: 118,481,397	A172S	probably damaging	Het
F2	T	C	2: 91,635,121		probably benign	Het
Gcc2	T	C	10: 58,269,695	V215A	possibly damaging	Het
Gm11677	C	T	11: 111,724,711		noncoding transcript	Het
Gm14548	A	T	7: 3,897,567	Y61*	probably null	Het
Gm20388	A	G	8: 122,271,133		probably benign	Het
Gm20671	T	C	5: 32,819,959	K1817R	possibly damaging	Het
Gm20939	T	A	17: 94,877,155	Y410*	probably null	Het
Gm27013	T	C	6: 130,676,915	Y528C	probably damaging	Het
Gm9992	T	C	17: 7,369,682	N149S	possibly damaging	Het
Il23r	T	C	6: 67,423,696	H550R	probably benign	Het
Iqgap1	A	T	7: 80,734,148	V1056E	probably damaging	Het
Lrit3	T	A	3: 129,788,301	Y679F	probably damaging	Het
Megf8	A	T	7: 25,341,706	E1120V	probably damaging	Het
Mta1	A	G	12: 113,131,957	E518G	probably damaging	Het
Myo9a	A	G	9: 59,907,382	I2200M	probably damaging	Het
Ncoa7	T	C	10: 30,722,729	H66R	probably benign	Het
Ncor1	A	G	11: 62,340,545	V812A	probably damaging	Het
Ndnf	T	C	6: 65,703,666	Y310H	possibly damaging	Het
Ndst1	G	A	18: 60,705,132	T347I	probably benign	Het
Olfr1229	A	T	2: 89,282,953	F60Y	probably benign	Het
Olfr512	T	C	7: 108,714,217	L276S	probably damaging	Het
Pcdhb10	C	A	18: 37,413,169	Q433K	probably benign	Het
Pcdhb18	G	A	18: 37,491,596	V660M	possibly damaging	Het
Pds5b	T	A	5: 150,723,353	N202K	possibly damaging	Het
Polk	T	C	13: 96,483,539	S718G	probably benign	Het
Ptpdc1	T	C	13: 48,590,698	D149G	probably damaging	Het
Rb1cc1	T	A	1: 6,249,193	C35*	probably null	Het
Shroom3	T	C	5: 92,962,248	M1739T	probably damaging	Het
Slc18a3	A	G	14: 32,463,748	L226P	probably damaging	Het
St7l	A	T	3: 104,868,060	Y84F	probably damaging	Het
Svil	A	T	18: 5,062,329	N392I	probably benign	Het
Syngr1	T	A	15: 80,098,039	M9K	probably benign	Het
Taar2	T	C	10: 23,941,032	S157P	probably damaging	Het
Tagap1	G	T	17: 6,956,096	Y400*	probably null	Het
Tbc1d8	T	A	1: 39,373,767	E976V	probably damaging	Het
Tmem163	G	A	1: 127,491,552		probably benign	Het
Tnfaip2	A	G	12: 111,448,460		probably benign	Het
Ttn	C	T	2: 76,706,517	S34988N	possibly damaging	Het
Tubg1	T	G	11: 101,120,238	N15K	probably damaging	Het
Vmn2r-ps159	G	T	4: 156,334,397		noncoding transcript	Het
Zap70	T	A	1: 36,781,365	V547D	probably damaging	Het
Zfp146	G	T	7: 30,162,475	N47K	probably benign	Het
Znrf1	T	G	8: 111,609,344	M159R	probably benign	Het

Other mutations in Samd9l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00538:Samd9l	APN	6	3376779	missense	probably damaging	0.96
IGL00550:Samd9l	APN	6	3374594	missense	probably benign	0.00
IGL01100:Samd9l	APN	6	3375863	missense	possibly damaging	0.91
IGL01321:Samd9l	APN	6	3376259	missense	probably benign	0.42
IGL01553:Samd9l	APN	6	3375566	missense	probably damaging	0.99
IGL01575:Samd9l	APN	6	3376734	missense	possibly damaging	0.85
IGL01896:Samd9l	APN	6	3375120	missense	probably benign	0.02
IGL01915:Samd9l	APN	6	3373864	nonsense	probably null
IGL02063:Samd9l	APN	6	3372992	missense	probably damaging	1.00
IGL02066:Samd9l	APN	6	3376575	missense	probably damaging	1.00
IGL02145:Samd9l	APN	6	3374105	missense	probably benign	0.13
IGL02163:Samd9l	APN	6	3374246	missense	possibly damaging	0.90
IGL02256:Samd9l	APN	6	3376197	missense	probably damaging	1.00
IGL02508:Samd9l	APN	6	3374798	missense	probably damaging	1.00
IGL02591:Samd9l	APN	6	3375760	missense	possibly damaging	0.91
IGL02968:Samd9l	APN	6	3376026	missense	probably damaging	1.00
IGL03058:Samd9l	APN	6	3374980	missense	probably damaging	0.99
IGL03068:Samd9l	APN	6	3375348	nonsense	probably null
IGL03160:Samd9l	APN	6	3374894	missense	probably damaging	1.00
IGL03372:Samd9l	APN	6	3375314	missense	probably damaging	1.00
IGL03385:Samd9l	APN	6	3376208	missense	probably damaging	0.99
boston_lager	UTSW	6	3375761	missense	probably benign	0.12
ipa	UTSW	6	3376347	missense	probably damaging	1.00
Paine	UTSW	6	3372716	missense	probably damaging	0.99
samad	UTSW	6	3374032	nonsense	probably null
IGL03054:Samd9l	UTSW	6	3376023	missense	probably damaging	1.00
R0111:Samd9l	UTSW	6	3374946	missense	possibly damaging	0.80
R0112:Samd9l	UTSW	6	3376031	missense	possibly damaging	0.93
R0356:Samd9l	UTSW	6	3375107	missense	possibly damaging	0.69
R0370:Samd9l	UTSW	6	3377264	start gained	probably benign
R0398:Samd9l	UTSW	6	3374502	missense	probably damaging	1.00
R0744:Samd9l	UTSW	6	3372725	missense	possibly damaging	0.92
R0833:Samd9l	UTSW	6	3372725	missense	possibly damaging	0.92
R0880:Samd9l	UTSW	6	3377064	missense	probably damaging	0.99
R1110:Samd9l	UTSW	6	3374267	missense	probably benign	0.44
R1155:Samd9l	UTSW	6	3376939	missense	probably benign	0.01
R1268:Samd9l	UTSW	6	3376113	missense	possibly damaging	0.56
R1293:Samd9l	UTSW	6	3373947	missense	possibly damaging	0.93
R1478:Samd9l	UTSW	6	3376369	missense	probably benign	0.06
R1573:Samd9l	UTSW	6	3375426	missense	probably damaging	0.99
R1590:Samd9l	UTSW	6	3375761	missense	probably benign	0.12
R1611:Samd9l	UTSW	6	3373771	missense	probably benign	0.00
R1754:Samd9l	UTSW	6	3373126	missense	probably damaging	0.96
R1759:Samd9l	UTSW	6	3373401	missense	probably damaging	1.00
R1795:Samd9l	UTSW	6	3375264	nonsense	probably null
R1829:Samd9l	UTSW	6	3375107	missense	possibly damaging	0.69
R1935:Samd9l	UTSW	6	3376269	missense	probably benign	0.01
R2154:Samd9l	UTSW	6	3372945	missense	possibly damaging	0.91
R2228:Samd9l	UTSW	6	3376910	missense	probably benign	0.08
R3622:Samd9l	UTSW	6	3374032	nonsense	probably null
R3903:Samd9l	UTSW	6	3376830	nonsense	probably null
R3904:Samd9l	UTSW	6	3376830	nonsense	probably null
R3945:Samd9l	UTSW	6	3377029	missense	possibly damaging	0.71
R4091:Samd9l	UTSW	6	3376887	missense	probably benign	0.22
R4602:Samd9l	UTSW	6	3373935	missense	probably damaging	1.00
R4602:Samd9l	UTSW	6	3373937	frame shift	probably null
R4618:Samd9l	UTSW	6	3376347	missense	probably damaging	1.00
R4747:Samd9l	UTSW	6	3375504	nonsense	probably null
R4762:Samd9l	UTSW	6	3375623	missense	probably benign	0.01
R4814:Samd9l	UTSW	6	3372863	missense	probably damaging	0.98
R4934:Samd9l	UTSW	6	3375621	nonsense	probably null
R5026:Samd9l	UTSW	6	3375284	missense	possibly damaging	0.75
R5048:Samd9l	UTSW	6	3374157	missense	probably benign	0.35
R5130:Samd9l	UTSW	6	3374548	missense	possibly damaging	0.69
R5328:Samd9l	UTSW	6	3376739	missense	probably damaging	0.99
R5507:Samd9l	UTSW	6	3373898	missense	possibly damaging	0.78
R5587:Samd9l	UTSW	6	3373291	missense	possibly damaging	0.84
R5846:Samd9l	UTSW	6	3376754	missense	probably benign
R5881:Samd9l	UTSW	6	3372716	missense	possibly damaging	0.70
R5889:Samd9l	UTSW	6	3376460	missense	probably damaging	1.00
R6131:Samd9l	UTSW	6	3377252	missense	probably benign	0.00
R6199:Samd9l	UTSW	6	3376686	missense	probably benign	0.13
R6298:Samd9l	UTSW	6	3375383	missense	probably damaging	1.00
R6331:Samd9l	UTSW	6	3376361	missense	probably damaging	1.00
R6489:Samd9l	UTSW	6	3376896	missense	probably benign
R6601:Samd9l	UTSW	6	3377229	missense	possibly damaging	0.74
R6655:Samd9l	UTSW	6	3377247	missense	probably benign	0.22
R6803:Samd9l	UTSW	6	3375446	missense	probably damaging	0.97
R6864:Samd9l	UTSW	6	3374750	missense	probably benign	0.14
R6905:Samd9l	UTSW	6	3375387	missense	probably damaging	0.99
R6919:Samd9l	UTSW	6	3376313	missense	possibly damaging	0.88
R7060:Samd9l	UTSW	6	3372716	missense	probably damaging	0.99
R7073:Samd9l	UTSW	6	3375856	nonsense	probably null
R7250:Samd9l	UTSW	6	3374201	missense	possibly damaging	0.78
R7307:Samd9l	UTSW	6	3372600	nonsense	probably null
R7351:Samd9l	UTSW	6	3374157	missense	probably benign	0.35
R7423:Samd9l	UTSW	6	3374408	missense	probably damaging	1.00
R7610:Samd9l	UTSW	6	3376754	missense	probably benign
R7667:Samd9l	UTSW	6	3375975	missense	possibly damaging	0.87
R7672:Samd9l	UTSW	6	3373646	missense	probably benign	0.16
R7680:Samd9l	UTSW	6	3372569	missense	probably damaging	1.00
R7680:Samd9l	UTSW	6	3376469	missense	probably damaging	1.00
R7814:Samd9l	UTSW	6	3374793	missense	possibly damaging	0.86
R7829:Samd9l	UTSW	6	3374749	missense	probably benign	0.00
R8000:Samd9l	UTSW	6	3373034	missense	probably damaging	1.00
R8098:Samd9l	UTSW	6	3375549	missense	probably damaging	1.00
R8698:Samd9l	UTSW	6	3373843	missense	probably benign	0.06
R8785:Samd9l	UTSW	6	3377064	missense	probably damaging	0.99
R8795:Samd9l	UTSW	6	3374221	nonsense	probably null
R8806:Samd9l	UTSW	6	3376665	missense	probably damaging	0.99
R8832:Samd9l	UTSW	6	3374990	missense	probably damaging	1.00
R8954:Samd9l	UTSW	6	3374577	missense	probably damaging	0.98
R9023:Samd9l	UTSW	6	3373791	missense	probably damaging	1.00
R9051:Samd9l	UTSW	6	3373493	missense	probably benign	0.16
R9108:Samd9l	UTSW	6	3373104	missense	possibly damaging	0.71
R9213:Samd9l	UTSW	6	3376856	missense	probably benign	0.23
R9494:Samd9l	UTSW	6	3375830	missense	possibly damaging	0.51
R9504:Samd9l	UTSW	6	3372621	missense	probably benign	0.17
R9655:Samd9l	UTSW	6	3373578	missense	probably benign	0.00
R9688:Samd9l	UTSW	6	3377087	missense	probably damaging	1.00
R9696:Samd9l	UTSW	6	3375078	missense	possibly damaging	0.76
R9721:Samd9l	UTSW	6	3375854	missense	possibly damaging	0.69
X0026:Samd9l	UTSW	6	3375560	missense	probably damaging	1.00
X0066:Samd9l	UTSW	6	3374477	missense	probably damaging	1.00
Z1176:Samd9l	UTSW	6	3376770	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGACCACTCCCTTGATGTGAG -3'
(R):5'- AGGTAGATGTTATTCCCAGACATTC -3'

Sequencing Primer
(F):5'- CCACTCCCTTGATGTGAGAATAAGG -3'
(R):5'- ATGCAAAGTAGCACAGGC -3'

Posted On

2016-07-06