Incidental Mutation 'R5271:Megf8'
ID400302
Institutional Source Beutler Lab
Gene Symbol Megf8
Ensembl Gene ENSMUSG00000045039
Gene Namemultiple EGF-like-domains 8
SynonymsEgfl4, b2b1702Clo, m687Ddg, b2b288Clo
MMRRC Submission 042861-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R5271 (G1)
Quality Score144
Status Validated
Chromosome7
Chromosomal Location25317164-25365917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25341706 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 1120 (E1120V)
Ref Sequence ENSEMBL: ENSMUSP00000122192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000128119]
Predicted Effect probably damaging
Transcript: ENSMUST00000128119
AA Change: E1120V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122192
Gene: ENSMUSG00000045039
AA Change: E1120V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CUB 33 140 1.24e-15 SMART
EGF 141 170 4.26e0 SMART
EGF 173 203 2.43e1 SMART
Pfam:Kelch_4 227 277 1.3e-11 PFAM
Pfam:Kelch_3 240 287 1.6e-7 PFAM
low complexity region 320 341 N/A INTRINSIC
low complexity region 517 531 N/A INTRINSIC
low complexity region 728 738 N/A INTRINSIC
PSI 847 899 1.37e0 SMART
low complexity region 932 938 N/A INTRINSIC
PSI 949 991 2.11e-2 SMART
PSI 1005 1073 7.82e-1 SMART
EGF_CA 1074 1115 2.62e-9 SMART
EGF 1117 1160 5.4e-2 SMART
EGF_like 1163 1208 4e-1 SMART
EGF_Lam 1211 1259 1.03e-7 SMART
Blast:CUB 1263 1401 1e-30 BLAST
EGF_like 1406 1445 3.29e1 SMART
Pfam:Kelch_4 1509 1564 6.5e-12 PFAM
Pfam:Kelch_3 1520 1574 1.2e-10 PFAM
PSI 1868 1923 2.75e-1 SMART
PSI 2004 2062 1.6e0 SMART
PSI 2064 2121 1.68e-5 SMART
EGF 2125 2164 1.08e-1 SMART
EGF 2166 2194 4.26e0 SMART
EGF 2204 2244 2.2e1 SMART
EGF_like 2248 2321 6.37e-1 SMART
low complexity region 2493 2504 N/A INTRINSIC
low complexity region 2530 2541 N/A INTRINSIC
transmembrane domain 2592 2614 N/A INTRINSIC
low complexity region 2649 2668 N/A INTRINSIC
low complexity region 2674 2702 N/A INTRINSIC
low complexity region 2759 2774 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153077
Meta Mutation Damage Score 0.182 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single-pass type I membrane protein of unknown function that contains several EGF-like domains, Kelch repeats, and PSI domains. Defects in this gene are a cause of Carpenter syndrome 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit varying degrees of heterotaxia and congenital heart defects. Mice homozygous for another ENU-induced mutation exhibit abnormal development and patterning of the peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T C 3: 124,579,847 K33R possibly damaging Het
4632415L05Rik C T 3: 19,895,147 noncoding transcript Het
4930542C16Rik A C 14: 24,615,530 noncoding transcript Het
Adprh A T 16: 38,446,054 L242* probably null Het
Anapc1 G A 2: 128,685,985 Q18* probably null Het
Bfar T C 16: 13,692,397 probably benign Het
Bmp1 T C 14: 70,508,128 I206V probably benign Het
Cc2d1b T A 4: 108,623,629 probably benign Het
Clock A G 5: 76,241,954 I349T probably damaging Het
Cox11 A G 11: 90,643,732 Y60C probably damaging Het
Cyp1a1 G A 9: 57,702,838 V512M probably benign Het
Dcdc2a T C 13: 25,187,688 F311S probably benign Het
Dnase1l3 T C 14: 7,993,843 D48G probably damaging Het
Engase G T 11: 118,481,397 A172S probably damaging Het
F2 T C 2: 91,635,121 probably benign Het
Gcc2 T C 10: 58,269,695 V215A possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm14548 A T 7: 3,897,567 Y61* probably null Het
Gm20388 A G 8: 122,271,133 probably benign Het
Gm20671 T C 5: 32,819,959 K1817R possibly damaging Het
Gm20939 T A 17: 94,877,155 Y410* probably null Het
Gm27013 T C 6: 130,676,915 Y528C probably damaging Het
Gm9992 T C 17: 7,369,682 N149S possibly damaging Het
Il23r T C 6: 67,423,696 H550R probably benign Het
Iqgap1 A T 7: 80,734,148 V1056E probably damaging Het
Lrit3 T A 3: 129,788,301 Y679F probably damaging Het
Mta1 A G 12: 113,131,957 E518G probably damaging Het
Myo9a A G 9: 59,907,382 I2200M probably damaging Het
Ncoa7 T C 10: 30,722,729 H66R probably benign Het
Ncor1 A G 11: 62,340,545 V812A probably damaging Het
Ndnf T C 6: 65,703,666 Y310H possibly damaging Het
Ndst1 G A 18: 60,705,132 T347I probably benign Het
Olfr1229 A T 2: 89,282,953 F60Y probably benign Het
Olfr512 T C 7: 108,714,217 L276S probably damaging Het
Pcdhb10 C A 18: 37,413,169 Q433K probably benign Het
Pcdhb18 G A 18: 37,491,596 V660M possibly damaging Het
Pds5b T A 5: 150,723,353 N202K possibly damaging Het
Polk T C 13: 96,483,539 S718G probably benign Het
Ptpdc1 T C 13: 48,590,698 D149G probably damaging Het
Rb1cc1 T A 1: 6,249,193 C35* probably null Het
Samd9l C T 6: 3,376,156 M368I probably benign Het
Shroom3 T C 5: 92,962,248 M1739T probably damaging Het
Slc18a3 A G 14: 32,463,748 L226P probably damaging Het
St7l A T 3: 104,868,060 Y84F probably damaging Het
Svil A T 18: 5,062,329 N392I probably benign Het
Syngr1 T A 15: 80,098,039 M9K probably benign Het
Taar2 T C 10: 23,941,032 S157P probably damaging Het
Tagap1 G T 17: 6,956,096 Y400* probably null Het
Tbc1d8 T A 1: 39,373,767 E976V probably damaging Het
Tmem163 G A 1: 127,491,552 probably benign Het
Tnfaip2 A G 12: 111,448,460 probably benign Het
Ttn C T 2: 76,706,517 S34988N possibly damaging Het
Tubg1 T G 11: 101,120,238 N15K probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zap70 T A 1: 36,781,365 V547D probably damaging Het
Zfp146 G T 7: 30,162,475 N47K probably benign Het
Znrf1 T G 8: 111,609,344 M159R probably benign Het
Other mutations in Megf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Megf8 APN 7 25343684 missense possibly damaging 0.87
IGL00696:Megf8 APN 7 25342392 missense probably benign
IGL01021:Megf8 APN 7 25338374 missense probably benign 0.39
IGL01290:Megf8 APN 7 25349658 nonsense probably null
IGL01392:Megf8 APN 7 25363749 missense probably benign 0.03
IGL01410:Megf8 APN 7 25359871 missense probably benign 0.01
IGL01634:Megf8 APN 7 25358781 splice site probably benign
IGL01648:Megf8 APN 7 25327572 missense probably damaging 1.00
IGL01930:Megf8 APN 7 25334861 missense probably damaging 1.00
IGL01954:Megf8 APN 7 25349014 missense possibly damaging 0.94
IGL02150:Megf8 APN 7 25346417 splice site probably null
IGL02192:Megf8 APN 7 25353860 missense probably damaging 1.00
IGL02250:Megf8 APN 7 25342575 missense probably benign 0.02
IGL02301:Megf8 APN 7 25337900 missense probably damaging 0.96
IGL02317:Megf8 APN 7 25363788 missense probably damaging 1.00
IGL02324:Megf8 APN 7 25340448 missense probably benign 0.10
IGL02503:Megf8 APN 7 25363563 missense possibly damaging 0.70
IGL02583:Megf8 APN 7 25355793 missense probably benign
IGL02636:Megf8 APN 7 25358432 missense probably damaging 0.99
IGL02704:Megf8 APN 7 25359782 missense probably damaging 0.97
IGL02898:Megf8 APN 7 25346508 missense possibly damaging 0.79
IGL03082:Megf8 APN 7 25330236 missense probably benign
IGL03182:Megf8 APN 7 25347348 missense possibly damaging 0.92
PIT4810001:Megf8 UTSW 7 25342285 missense probably damaging 1.00
R0076:Megf8 UTSW 7 25353958 critical splice donor site probably null
R0217:Megf8 UTSW 7 25364079 missense probably damaging 0.99
R0514:Megf8 UTSW 7 25364303 missense possibly damaging 0.86
R0561:Megf8 UTSW 7 25328832 missense probably benign 0.21
R0563:Megf8 UTSW 7 25342395 missense probably damaging 1.00
R0601:Megf8 UTSW 7 25328540 missense probably benign 0.03
R0879:Megf8 UTSW 7 25338471 missense possibly damaging 0.58
R1323:Megf8 UTSW 7 25360102 splice site probably null
R1323:Megf8 UTSW 7 25360102 splice site probably null
R1430:Megf8 UTSW 7 25364343 missense possibly damaging 0.86
R1445:Megf8 UTSW 7 25342656 missense probably damaging 0.97
R1533:Megf8 UTSW 7 25334855 missense possibly damaging 0.70
R1606:Megf8 UTSW 7 25358695 missense probably damaging 1.00
R1635:Megf8 UTSW 7 25346747 missense possibly damaging 0.77
R1654:Megf8 UTSW 7 25338486 missense possibly damaging 0.56
R1661:Megf8 UTSW 7 25363847 missense probably damaging 1.00
R1880:Megf8 UTSW 7 25334860 missense possibly damaging 0.68
R1962:Megf8 UTSW 7 25363551 missense probably damaging 1.00
R2077:Megf8 UTSW 7 25353738 missense probably benign 0.15
R2127:Megf8 UTSW 7 25364582 missense possibly damaging 0.73
R2129:Megf8 UTSW 7 25330715 missense probably damaging 0.98
R2199:Megf8 UTSW 7 25339614 missense possibly damaging 0.87
R2201:Megf8 UTSW 7 25340745 missense probably damaging 1.00
R2205:Megf8 UTSW 7 25341748 missense probably benign 0.13
R2207:Megf8 UTSW 7 25349797 missense probably damaging 0.97
R2361:Megf8 UTSW 7 25348954 missense possibly damaging 0.94
R2680:Megf8 UTSW 7 25317556 missense probably benign 0.01
R3084:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3085:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3086:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3433:Megf8 UTSW 7 25360124 missense probably benign 0.00
R3939:Megf8 UTSW 7 25359202 missense probably benign 0.07
R4022:Megf8 UTSW 7 25337775 missense probably damaging 1.00
R4214:Megf8 UTSW 7 25355368 missense probably benign 0.03
R4357:Megf8 UTSW 7 25355749 missense probably benign 0.02
R4521:Megf8 UTSW 7 25342701 missense probably benign 0.19
R4620:Megf8 UTSW 7 25355098 missense possibly damaging 0.92
R4700:Megf8 UTSW 7 25363515 missense probably damaging 1.00
R4916:Megf8 UTSW 7 25339664 missense probably benign 0.24
R4940:Megf8 UTSW 7 25360706 missense probably damaging 1.00
R5048:Megf8 UTSW 7 25331092 missense possibly damaging 0.71
R5258:Megf8 UTSW 7 25348326 missense possibly damaging 0.88
R5390:Megf8 UTSW 7 25340289 missense possibly damaging 0.92
R5391:Megf8 UTSW 7 25340289 missense possibly damaging 0.92
R5708:Megf8 UTSW 7 25334597 missense probably benign 0.03
R5752:Megf8 UTSW 7 25355114 missense probably damaging 0.97
R5930:Megf8 UTSW 7 25326441 nonsense probably null
R6037:Megf8 UTSW 7 25364406 missense probably damaging 1.00
R6037:Megf8 UTSW 7 25364406 missense probably damaging 1.00
R6153:Megf8 UTSW 7 25347371 missense possibly damaging 0.93
R6210:Megf8 UTSW 7 25343720 missense possibly damaging 0.90
R6457:Megf8 UTSW 7 25349695 missense probably damaging 0.99
R6659:Megf8 UTSW 7 25358734 missense probably benign 0.38
R6867:Megf8 UTSW 7 25331035 missense probably benign 0.42
R6896:Megf8 UTSW 7 25329932 missense probably benign 0.00
R6899:Megf8 UTSW 7 25360713 missense probably damaging 1.00
R6905:Megf8 UTSW 7 25337932 missense probably benign 0.02
R7099:Megf8 UTSW 7 25346520 missense probably damaging 0.99
R7172:Megf8 UTSW 7 25343667 missense probably damaging 0.99
R7378:Megf8 UTSW 7 25348942 missense probably damaging 1.00
R7427:Megf8 UTSW 7 25338371 missense probably benign 0.44
R7492:Megf8 UTSW 7 25353848 missense probably benign 0.24
Z1088:Megf8 UTSW 7 25339669 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGAGAGTGTTGCCTTGGAAAC -3'
(R):5'- CCCAAGCTGCTTCAAAGAGTC -3'

Sequencing Primer
(F):5'- ACACGTTTACTTGCATGCACAGG -3'
(R):5'- ACTCGTCACAGTAGCCAGGTC -3'
Posted On2016-07-06