Incidental Mutation 'R5271:Iqgap1'
ID400306
Institutional Source Beutler Lab
Gene Symbol Iqgap1
Ensembl Gene ENSMUSG00000030536
Gene NameIQ motif containing GTPase activating protein 1
SynonymsD7Ertd237e, D7Ertd257e
MMRRC Submission 042861-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5271 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location80711583-80825974 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80734148 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1056 (V1056E)
Ref Sequence ENSEMBL: ENSMUSP00000128278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167377]
Predicted Effect probably damaging
Transcript: ENSMUST00000167377
AA Change: V1056E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128278
Gene: ENSMUSG00000030536
AA Change: V1056E

DomainStartEndE-ValueType
CH 46 155 2.02e-20 SMART
internal_repeat_1 203 278 3.71e-8 PROSPERO
low complexity region 324 335 N/A INTRINSIC
low complexity region 390 399 N/A INTRINSIC
coiled coil region 488 515 N/A INTRINSIC
internal_repeat_1 608 684 3.71e-8 PROSPERO
IQ 744 766 3.85e-3 SMART
IQ 774 796 1.12e-4 SMART
IQ 804 826 1.32e-1 SMART
IQ 834 856 1.15e1 SMART
coiled coil region 886 914 N/A INTRINSIC
RasGAP 992 1345 7.46e-89 SMART
Pfam:RasGAP_C 1452 1580 4.5e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205606
Meta Mutation Damage Score 0.7880 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains four IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. Expression of the protein is upregulated by gene amplification in two gastric cancer cell lines. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null allele exhibit a late-onset gastric hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T C 3: 124,579,847 K33R possibly damaging Het
4632415L05Rik C T 3: 19,895,147 noncoding transcript Het
4930542C16Rik A C 14: 24,615,530 noncoding transcript Het
Adprh A T 16: 38,446,054 L242* probably null Het
Anapc1 G A 2: 128,685,985 Q18* probably null Het
Bfar T C 16: 13,692,397 probably benign Het
Bmp1 T C 14: 70,508,128 I206V probably benign Het
Cc2d1b T A 4: 108,623,629 probably benign Het
Clock A G 5: 76,241,954 I349T probably damaging Het
Cox11 A G 11: 90,643,732 Y60C probably damaging Het
Cyp1a1 G A 9: 57,702,838 V512M probably benign Het
Dcdc2a T C 13: 25,187,688 F311S probably benign Het
Dnase1l3 T C 14: 7,993,843 D48G probably damaging Het
Engase G T 11: 118,481,397 A172S probably damaging Het
F2 T C 2: 91,635,121 probably benign Het
Gcc2 T C 10: 58,269,695 V215A possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm14548 A T 7: 3,897,567 Y61* probably null Het
Gm20388 A G 8: 122,271,133 probably benign Het
Gm20671 T C 5: 32,819,959 K1817R possibly damaging Het
Gm20939 T A 17: 94,877,155 Y410* probably null Het
Gm27013 T C 6: 130,676,915 Y528C probably damaging Het
Gm9992 T C 17: 7,369,682 N149S possibly damaging Het
Il23r T C 6: 67,423,696 H550R probably benign Het
Lrit3 T A 3: 129,788,301 Y679F probably damaging Het
Megf8 A T 7: 25,341,706 E1120V probably damaging Het
Mta1 A G 12: 113,131,957 E518G probably damaging Het
Myo9a A G 9: 59,907,382 I2200M probably damaging Het
Ncoa7 T C 10: 30,722,729 H66R probably benign Het
Ncor1 A G 11: 62,340,545 V812A probably damaging Het
Ndnf T C 6: 65,703,666 Y310H possibly damaging Het
Ndst1 G A 18: 60,705,132 T347I probably benign Het
Olfr1229 A T 2: 89,282,953 F60Y probably benign Het
Olfr512 T C 7: 108,714,217 L276S probably damaging Het
Pcdhb10 C A 18: 37,413,169 Q433K probably benign Het
Pcdhb18 G A 18: 37,491,596 V660M possibly damaging Het
Pds5b T A 5: 150,723,353 N202K possibly damaging Het
Polk T C 13: 96,483,539 S718G probably benign Het
Ptpdc1 T C 13: 48,590,698 D149G probably damaging Het
Rb1cc1 T A 1: 6,249,193 C35* probably null Het
Samd9l C T 6: 3,376,156 M368I probably benign Het
Shroom3 T C 5: 92,962,248 M1739T probably damaging Het
Slc18a3 A G 14: 32,463,748 L226P probably damaging Het
St7l A T 3: 104,868,060 Y84F probably damaging Het
Svil A T 18: 5,062,329 N392I probably benign Het
Syngr1 T A 15: 80,098,039 M9K probably benign Het
Taar2 T C 10: 23,941,032 S157P probably damaging Het
Tagap1 G T 17: 6,956,096 Y400* probably null Het
Tbc1d8 T A 1: 39,373,767 E976V probably damaging Het
Tmem163 G A 1: 127,491,552 probably benign Het
Tnfaip2 A G 12: 111,448,460 probably benign Het
Ttn C T 2: 76,706,517 S34988N possibly damaging Het
Tubg1 T G 11: 101,120,238 N15K probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zap70 T A 1: 36,781,365 V547D probably damaging Het
Zfp146 G T 7: 30,162,475 N47K probably benign Het
Znrf1 T G 8: 111,609,344 M159R probably benign Het
Other mutations in Iqgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Iqgap1 APN 7 80759844 missense probably benign 0.00
IGL00984:Iqgap1 APN 7 80726798 missense probably damaging 1.00
IGL01570:Iqgap1 APN 7 80723061 missense possibly damaging 0.76
IGL01738:Iqgap1 APN 7 80723900 missense possibly damaging 0.80
IGL02141:Iqgap1 APN 7 80738121 missense probably damaging 1.00
IGL02336:Iqgap1 APN 7 80752293 missense probably benign 0.39
IGL02416:Iqgap1 APN 7 80726038 missense probably damaging 1.00
IGL02597:Iqgap1 APN 7 80723885 missense probably damaging 1.00
IGL02662:Iqgap1 APN 7 80743079 missense probably benign
IGL03157:Iqgap1 APN 7 80751888 missense probably benign 0.34
IGL03189:Iqgap1 APN 7 80713842 missense probably benign 0.12
IGL03216:Iqgap1 APN 7 80743088 missense probably benign 0.33
R0024:Iqgap1 UTSW 7 80751939 missense probably benign
R0126:Iqgap1 UTSW 7 80738322 missense probably benign 0.00
R0144:Iqgap1 UTSW 7 80751920 missense probably damaging 1.00
R0325:Iqgap1 UTSW 7 80751930 missense probably benign 0.01
R0376:Iqgap1 UTSW 7 80723879 missense probably benign 0.01
R0650:Iqgap1 UTSW 7 80736395 missense probably damaging 1.00
R0652:Iqgap1 UTSW 7 80736395 missense probably damaging 1.00
R0741:Iqgap1 UTSW 7 80720987 missense probably benign 0.03
R0751:Iqgap1 UTSW 7 80725573 unclassified probably benign
R1067:Iqgap1 UTSW 7 80723828 missense probably benign 0.01
R1389:Iqgap1 UTSW 7 80759756 critical splice donor site probably null
R1473:Iqgap1 UTSW 7 80734011 missense probably benign 0.00
R1613:Iqgap1 UTSW 7 80768457 missense probably damaging 1.00
R1842:Iqgap1 UTSW 7 80760883 missense probably damaging 1.00
R1909:Iqgap1 UTSW 7 80743828 missense probably benign
R2062:Iqgap1 UTSW 7 80723979 nonsense probably null
R2149:Iqgap1 UTSW 7 80762560 missense probably damaging 1.00
R2153:Iqgap1 UTSW 7 80751953 missense probably benign 0.00
R2153:Iqgap1 UTSW 7 80759903 missense possibly damaging 0.55
R3160:Iqgap1 UTSW 7 80752338 missense probably benign
R3162:Iqgap1 UTSW 7 80752338 missense probably benign
R3605:Iqgap1 UTSW 7 80723789 missense probably benign 0.02
R3709:Iqgap1 UTSW 7 80717087 missense possibly damaging 0.87
R3935:Iqgap1 UTSW 7 80743837 missense possibly damaging 0.54
R3979:Iqgap1 UTSW 7 80759934 missense probably damaging 0.98
R4545:Iqgap1 UTSW 7 80762567 critical splice acceptor site probably null
R4787:Iqgap1 UTSW 7 80735513 missense probably damaging 1.00
R4925:Iqgap1 UTSW 7 80765317 missense probably damaging 1.00
R4953:Iqgap1 UTSW 7 80723776 splice site probably null
R5037:Iqgap1 UTSW 7 80734100 missense probably damaging 1.00
R5158:Iqgap1 UTSW 7 80743068 missense probably benign 0.02
R5183:Iqgap1 UTSW 7 80723065 missense probably damaging 1.00
R5262:Iqgap1 UTSW 7 80726742 missense probably benign 0.00
R5289:Iqgap1 UTSW 7 80738724 missense possibly damaging 0.88
R5359:Iqgap1 UTSW 7 80766959 missense probably benign 0.00
R5423:Iqgap1 UTSW 7 80799862 missense probably damaging 1.00
R5843:Iqgap1 UTSW 7 80726080 missense probably benign 0.03
R5849:Iqgap1 UTSW 7 80803158 missense probably benign
R6164:Iqgap1 UTSW 7 80809106 missense unknown
R6315:Iqgap1 UTSW 7 80799890 missense possibly damaging 0.65
R6335:Iqgap1 UTSW 7 80728024 missense probably damaging 1.00
R6488:Iqgap1 UTSW 7 80730326 missense probably benign 0.00
R6723:Iqgap1 UTSW 7 80723822 missense probably benign 0.01
R6800:Iqgap1 UTSW 7 80728981 missense possibly damaging 0.56
R6815:Iqgap1 UTSW 7 80766884 critical splice donor site probably null
R7240:Iqgap1 UTSW 7 80759839 missense probably benign 0.22
R7386:Iqgap1 UTSW 7 80726042 missense probably damaging 1.00
R7387:Iqgap1 UTSW 7 80720990 missense probably benign 0.03
R7410:Iqgap1 UTSW 7 80723030 nonsense probably null
R7429:Iqgap1 UTSW 7 80751440 missense probably benign 0.00
R7452:Iqgap1 UTSW 7 80760829 missense possibly damaging 0.80
R7615:Iqgap1 UTSW 7 80730100 missense probably damaging 1.00
R7615:Iqgap1 UTSW 7 80751346 missense probably benign
R7726:Iqgap1 UTSW 7 80757456 missense probably benign 0.37
R7783:Iqgap1 UTSW 7 80809059 missense probably benign 0.01
R7785:Iqgap1 UTSW 7 80738169 missense probably damaging 1.00
R7862:Iqgap1 UTSW 7 80743888 missense probably benign 0.04
R8270:Iqgap1 UTSW 7 80730127 missense probably damaging 1.00
R8556:Iqgap1 UTSW 7 80726039 missense probably damaging 1.00
RF004:Iqgap1 UTSW 7 80720875 missense probably benign
RF063:Iqgap1 UTSW 7 80723751 frame shift probably null
X0064:Iqgap1 UTSW 7 80720931 nonsense probably null
X0067:Iqgap1 UTSW 7 80766903 missense probably benign
Z1176:Iqgap1 UTSW 7 80768309 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTTTGCAAATCAGAAGGAACTGC -3'
(R):5'- GGAATGCTGGGAAATGCTTC -3'

Sequencing Primer
(F):5'- TTTAAACAGATACGAAAACAGCAAAC -3'
(R):5'- TTCCAGGGGAAGACTTGACCTG -3'
Posted On2016-07-06