Incidental Mutation 'R5197:Lgr6'
ID400307
Institutional Source Beutler Lab
Gene Symbol Lgr6
Ensembl Gene ENSMUSG00000042793
Gene Nameleucine-rich repeat-containing G protein-coupled receptor 6
SynonymsA530037C04Rik
MMRRC Submission 042773-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5197 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location134983301-135105276 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 134994010 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 199 (A199T)
Ref Sequence ENSEMBL: ENSMUSP00000122334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044828] [ENSMUST00000137968]
Predicted Effect probably damaging
Transcript: ENSMUST00000044828
AA Change: A476T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035444
Gene: ENSMUSG00000042793
AA Change: A476T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
LRRNT 34 70 5.19e-3 SMART
LRR 64 88 1.03e1 SMART
LRR_TYP 89 112 6.52e-5 SMART
LRR_TYP 113 136 2.71e-2 SMART
LRR_TYP 137 160 4.79e-3 SMART
LRR_TYP 161 184 1.58e-3 SMART
LRR_TYP 185 208 2.36e-2 SMART
LRR_TYP 209 232 3.39e-3 SMART
LRR 233 255 8.97e0 SMART
LRR_TYP 256 279 1.36e-2 SMART
Blast:LRR 281 303 6e-7 BLAST
LRR 327 350 9.24e1 SMART
LRR 351 373 1.41e0 SMART
LRR 374 396 4.84e1 SMART
LRR_TYP 397 420 4.54e-4 SMART
LRR_TYP 421 444 7.15e-2 SMART
transmembrane domain 568 590 N/A INTRINSIC
transmembrane domain 599 621 N/A INTRINSIC
transmembrane domain 643 665 N/A INTRINSIC
transmembrane domain 686 708 N/A INTRINSIC
transmembrane domain 728 750 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 808 830 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137968
AA Change: A199T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122334
Gene: ENSMUSG00000042793
AA Change: A199T

DomainStartEndE-ValueType
Blast:LRR 4 26 2e-7 BLAST
LRR 50 73 9.24e1 SMART
LRR 74 96 1.41e0 SMART
LRR 97 119 4.84e1 SMART
LRR_TYP 120 143 4.54e-4 SMART
LRR_TYP 144 167 7.15e-2 SMART
Pfam:7tm_1 301 550 3.6e-9 PFAM
Meta Mutation Damage Score 0.1650 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane protein superfamily. The encoded protein is a glycoprotein hormone receptor with a large N-terminal extracellular domain that contains leucine-rich repeats important for the formation of a horseshoe-shaped interaction motif for ligand binding. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter/null allele are viable and fertile with no apparent abnormal phenotype. Similarly, mice homozygous for a knock-in allele are healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg1 T C 9: 54,622,582 E247G possibly damaging Het
Adgra3 A G 5: 49,960,754 F1151L probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Aldh4a1 A C 4: 139,648,301 probably benign Het
Anln A T 9: 22,352,781 probably null Het
Aste1 T C 9: 105,405,054 S74P probably damaging Het
Atp6v0e2 G A 6: 48,540,117 R77H probably benign Het
Brpf1 A G 6: 113,319,941 D962G possibly damaging Het
Btbd2 T C 10: 80,646,419 D249G probably damaging Het
Catsper3 T C 13: 55,808,176 probably null Het
Cfap43 A G 19: 47,897,372 L268P probably damaging Het
Cftr T C 6: 18,255,414 V540A probably benign Het
Col22a1 C T 15: 72,009,406 G32D probably damaging Het
Col5a2 G T 1: 45,393,081 P804Q probably benign Het
Cyp2d41-ps A G 15: 82,778,780 noncoding transcript Het
Cyp39a1 T G 17: 43,746,538 L423V possibly damaging Het
Elmo1 T G 13: 20,564,437 V484G probably benign Het
Eps8 C A 6: 137,490,290 Q656H probably damaging Het
Eps8 T C 6: 137,490,291 Q656R possibly damaging Het
Fam71f2 G T 6: 29,281,222 probably benign Het
Fshb T C 2: 107,057,509 D55G possibly damaging Het
Gm13089 A C 4: 143,698,062 C270W possibly damaging Het
Herc1 C A 9: 66,448,504 Q2346K probably damaging Het
Hist1h3d T A 13: 23,576,130 L110Q probably damaging Het
Htr3b T C 9: 48,945,515 D221G probably benign Het
Ift74 T A 4: 94,662,596 D328E probably benign Het
Kif21b A T 1: 136,144,625 K23M probably damaging Het
Lipc T A 9: 70,798,391 E470V probably benign Het
Lrrc4 G T 6: 28,830,143 T68K probably damaging Het
Lrrc63 T A 14: 75,084,882 H594L possibly damaging Het
Mfsd14a A T 3: 116,648,501 probably benign Het
Mob2 T C 7: 142,009,537 probably null Het
Nckap5 T A 1: 126,222,673 H105L possibly damaging Het
Ngef C A 1: 87,509,368 G133* probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1000 T C 2: 85,608,447 I154M probably benign Het
Olfr113 T G 17: 37,575,220 I68L probably benign Het
Olfr1477 G T 19: 13,502,384 V14F possibly damaging Het
Olfr31 T A 14: 14,328,462 M117K probably damaging Het
Olfr593 G A 7: 103,212,000 V47I probably benign Het
Pard3 A G 8: 127,073,290 probably null Het
Pgm1 C T 5: 64,105,832 A274V possibly damaging Het
Ppp1r9a T A 6: 5,156,177 S1144R probably damaging Het
Prkcq C T 2: 11,299,416 P590L probably damaging Het
Psmd13 T A 7: 140,894,461 probably null Het
Rab3gap1 T A 1: 127,889,194 D63E probably benign Het
Rag2 C A 2: 101,630,740 T465K probably damaging Het
Rnase6 A G 14: 51,130,213 M21V unknown Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 A T 13: 11,638,430 probably null Het
Sash1 T G 10: 8,740,225 R624S probably damaging Het
Slc1a2 A G 2: 102,756,115 I355V probably benign Het
Srrm2 T C 17: 23,817,384 S1097P probably benign Het
Sugct C T 13: 17,323,276 A271T probably damaging Het
Tdrd7 T C 4: 46,034,350 V1065A probably damaging Het
Tmprss6 T A 15: 78,454,189 Y307F probably damaging Het
Tram1 T C 1: 13,571,902 N216S probably benign Het
Ttk T C 9: 83,839,341 V93A probably benign Het
Ubr4 A G 4: 139,468,097 Y1210C probably damaging Het
Wdr7 A G 18: 63,738,866 K364E probably benign Het
Xrcc2 G T 5: 25,692,658 H98N probably benign Het
Zdhhc11 A G 13: 73,965,569 I77V probably benign Het
Zfp54 C T 17: 21,434,180 S312L probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Lgr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02481:Lgr6 APN 1 135001691 splice site probably benign
IGL02483:Lgr6 APN 1 135001691 splice site probably benign
IGL03270:Lgr6 APN 1 134997704 missense probably damaging 1.00
R0002:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0294:Lgr6 UTSW 1 134987891 missense probably damaging 0.99
R0294:Lgr6 UTSW 1 135105061 missense unknown
R0361:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0390:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0731:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0734:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0741:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0742:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0765:Lgr6 UTSW 1 134993886 missense probably benign 0.04
R0903:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0904:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0905:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0906:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0907:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0908:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0967:Lgr6 UTSW 1 134994012 missense probably damaging 1.00
R1078:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R1079:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R1131:Lgr6 UTSW 1 134987304 missense probably damaging 0.98
R1440:Lgr6 UTSW 1 134987472 missense probably damaging 1.00
R1533:Lgr6 UTSW 1 135104932 missense possibly damaging 0.66
R1728:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1728:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1728:Lgr6 UTSW 1 135003476 missense probably benign
R1729:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1729:Lgr6 UTSW 1 134988009 missense probably benign
R1729:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1729:Lgr6 UTSW 1 135003476 missense probably benign
R1730:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1730:Lgr6 UTSW 1 134988009 missense probably benign
R1730:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1730:Lgr6 UTSW 1 135003476 missense probably benign
R1739:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1739:Lgr6 UTSW 1 134988009 missense probably benign
R1739:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1739:Lgr6 UTSW 1 135003476 missense probably benign
R1762:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1762:Lgr6 UTSW 1 134988009 missense probably benign
R1762:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1762:Lgr6 UTSW 1 135003476 missense probably benign
R1782:Lgr6 UTSW 1 134987979 missense probably damaging 0.98
R1783:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1783:Lgr6 UTSW 1 134988009 missense probably benign
R1783:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1783:Lgr6 UTSW 1 135003476 missense probably benign
R1784:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1784:Lgr6 UTSW 1 134988009 missense probably benign
R1784:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1784:Lgr6 UTSW 1 135003476 missense probably benign
R1785:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1785:Lgr6 UTSW 1 134988009 missense probably benign
R1785:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1785:Lgr6 UTSW 1 135003476 missense probably benign
R2020:Lgr6 UTSW 1 135075275 missense probably damaging 1.00
R3104:Lgr6 UTSW 1 135000472 splice site probably null
R4629:Lgr6 UTSW 1 135104932 missense probably damaging 0.99
R4792:Lgr6 UTSW 1 135021806 missense probably benign 0.03
R5001:Lgr6 UTSW 1 134990632 missense probably benign 0.01
R5191:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5194:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5195:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5196:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5228:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5230:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5243:Lgr6 UTSW 1 135109272 unclassified probably benign
R5299:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5300:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5417:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5419:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5601:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5603:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5636:Lgr6 UTSW 1 134987078 missense probably benign 0.28
R5699:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5748:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5767:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5825:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5971:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6078:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6079:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6138:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6258:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6259:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6260:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6740:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6871:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6984:Lgr6 UTSW 1 134988002 missense possibly damaging 0.54
R6986:Lgr6 UTSW 1 134993956 missense possibly damaging 0.80
R7233:Lgr6 UTSW 1 135000476 critical splice donor site probably null
R7699:Lgr6 UTSW 1 134996032 missense probably damaging 1.00
R7700:Lgr6 UTSW 1 134996032 missense probably damaging 1.00
R7734:Lgr6 UTSW 1 135003243 missense probably damaging 1.00
R7849:Lgr6 UTSW 1 134987681 missense probably damaging 1.00
R7970:Lgr6 UTSW 1 134993985 missense probably benign
R8068:Lgr6 UTSW 1 135063664 missense probably benign 0.00
R8252:Lgr6 UTSW 1 135003477 missense probably null 0.78
R8516:Lgr6 UTSW 1 135075283 missense probably damaging 1.00
Z1088:Lgr6 UTSW 1 134988071 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGAGTAGGCCACTTCCTTCG -3'
(R):5'- GGAATCAGGCTTCAAGATTCCTC -3'

Sequencing Primer
(F):5'- TTCCTTCGGGGTCACAAGGATC -3'
(R):5'- TTATGGTTGCAAGTCACCACAGC -3'
Posted On2016-07-06