Incidental Mutation 'R5271:Znrf1'
ID 400312
Institutional Source Beutler Lab
Gene Symbol Znrf1
Ensembl Gene ENSMUSG00000033545
Gene Name zinc and ring finger 1
Synonyms Zrfp1, nin283, B830022L21Rik, Rnf42
MMRRC Submission 042861-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock # R5271 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 111536097-111626030 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 111609344 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Arginine at position 159 (M159R)
Ref Sequence ENSEMBL: ENSMUSP00000133993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095176] [ENSMUST00000166859] [ENSMUST00000168428] [ENSMUST00000171182] [ENSMUST00000172856] [ENSMUST00000173506] [ENSMUST00000173781] [ENSMUST00000174333] [ENSMUST00000174454]
AlphaFold Q91V17
Predicted Effect probably benign
Transcript: ENSMUST00000095176
AA Change: M159R

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000092799
Gene: ENSMUSG00000033545
AA Change: M159R

DomainStartEndE-ValueType
RING 184 224 2.98e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166859
AA Change: M59R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000132939
Gene: ENSMUSG00000033545
AA Change: M59R

DomainStartEndE-ValueType
RING 84 124 2.98e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168428
AA Change: M159R

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126684
Gene: ENSMUSG00000033545
AA Change: M159R

DomainStartEndE-ValueType
RING 184 224 2.98e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171182
SMART Domains Protein: ENSMUSP00000127956
Gene: ENSMUSG00000033545

DomainStartEndE-ValueType
RING 152 192 2.98e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172856
AA Change: M159R

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133309
Gene: ENSMUSG00000033545
AA Change: M159R

DomainStartEndE-ValueType
RING 184 224 2.98e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173481
Predicted Effect probably benign
Transcript: ENSMUST00000173506
AA Change: M159R

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133993
Gene: ENSMUSG00000033545
AA Change: M159R

DomainStartEndE-ValueType
RING 184 224 2.98e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173692
Predicted Effect probably benign
Transcript: ENSMUST00000173726
SMART Domains Protein: ENSMUSP00000133472
Gene: ENSMUSG00000033545

DomainStartEndE-ValueType
RING 45 85 2.98e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173781
SMART Domains Protein: ENSMUSP00000134232
Gene: ENSMUSG00000033545

DomainStartEndE-ValueType
RING 22 62 2.98e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000173819
AA Change: M16R
Predicted Effect probably benign
Transcript: ENSMUST00000173922
Predicted Effect probably benign
Transcript: ENSMUST00000174333
AA Change: M59R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000134634
Gene: ENSMUSG00000033545
AA Change: M59R

DomainStartEndE-ValueType
RING 84 124 2.98e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174454
SMART Domains Protein: ENSMUSP00000133519
Gene: ENSMUSG00000033545

DomainStartEndE-ValueType
RING 22 62 2.98e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174376
Meta Mutation Damage Score 0.1389 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase that plays a role in neural-cell differentiation. Overexpression of this gene causes neurite-like elongation. The encoded protein contains both a zinc finger and a RING finger motif and is localized in the endosome/lysosome compartment, indicating that it may be involved in ubiquitin-mediated protein modification, and in synaptic vessicle membranes in neurons. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T C 3: 124,579,847 K33R possibly damaging Het
4632415L05Rik C T 3: 19,895,147 noncoding transcript Het
4930542C16Rik A C 14: 24,615,530 noncoding transcript Het
Adprh A T 16: 38,446,054 L242* probably null Het
Anapc1 G A 2: 128,685,985 Q18* probably null Het
Bfar T C 16: 13,692,397 probably benign Het
Bmp1 T C 14: 70,508,128 I206V probably benign Het
Cc2d1b T A 4: 108,623,629 probably benign Het
Clock A G 5: 76,241,954 I349T probably damaging Het
Cox11 A G 11: 90,643,732 Y60C probably damaging Het
Cyp1a1 G A 9: 57,702,838 V512M probably benign Het
Dcdc2a T C 13: 25,187,688 F311S probably benign Het
Dnase1l3 T C 14: 7,993,843 D48G probably damaging Het
Engase G T 11: 118,481,397 A172S probably damaging Het
F2 T C 2: 91,635,121 probably benign Het
Gcc2 T C 10: 58,269,695 V215A possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm14548 A T 7: 3,897,567 Y61* probably null Het
Gm20388 A G 8: 122,271,133 probably benign Het
Gm20671 T C 5: 32,819,959 K1817R possibly damaging Het
Gm20939 T A 17: 94,877,155 Y410* probably null Het
Gm27013 T C 6: 130,676,915 Y528C probably damaging Het
Gm9992 T C 17: 7,369,682 N149S possibly damaging Het
Il23r T C 6: 67,423,696 H550R probably benign Het
Iqgap1 A T 7: 80,734,148 V1056E probably damaging Het
Lrit3 T A 3: 129,788,301 Y679F probably damaging Het
Megf8 A T 7: 25,341,706 E1120V probably damaging Het
Mta1 A G 12: 113,131,957 E518G probably damaging Het
Myo9a A G 9: 59,907,382 I2200M probably damaging Het
Ncoa7 T C 10: 30,722,729 H66R probably benign Het
Ncor1 A G 11: 62,340,545 V812A probably damaging Het
Ndnf T C 6: 65,703,666 Y310H possibly damaging Het
Ndst1 G A 18: 60,705,132 T347I probably benign Het
Olfr1229 A T 2: 89,282,953 F60Y probably benign Het
Olfr512 T C 7: 108,714,217 L276S probably damaging Het
Pcdhb10 C A 18: 37,413,169 Q433K probably benign Het
Pcdhb18 G A 18: 37,491,596 V660M possibly damaging Het
Pds5b T A 5: 150,723,353 N202K possibly damaging Het
Polk T C 13: 96,483,539 S718G probably benign Het
Ptpdc1 T C 13: 48,590,698 D149G probably damaging Het
Rb1cc1 T A 1: 6,249,193 C35* probably null Het
Samd9l C T 6: 3,376,156 M368I probably benign Het
Shroom3 T C 5: 92,962,248 M1739T probably damaging Het
Slc18a3 A G 14: 32,463,748 L226P probably damaging Het
St7l A T 3: 104,868,060 Y84F probably damaging Het
Svil A T 18: 5,062,329 N392I probably benign Het
Syngr1 T A 15: 80,098,039 M9K probably benign Het
Taar2 T C 10: 23,941,032 S157P probably damaging Het
Tagap1 G T 17: 6,956,096 Y400* probably null Het
Tbc1d8 T A 1: 39,373,767 E976V probably damaging Het
Tmem163 G A 1: 127,491,552 probably benign Het
Tnfaip2 A G 12: 111,448,460 probably benign Het
Ttn C T 2: 76,706,517 S34988N possibly damaging Het
Tubg1 T G 11: 101,120,238 N15K probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zap70 T A 1: 36,781,365 V547D probably damaging Het
Zfp146 G T 7: 30,162,475 N47K probably benign Het
Other mutations in Znrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1029:Znrf1 UTSW 8 111537354 missense probably damaging 0.99
R1911:Znrf1 UTSW 8 111621601 makesense probably null
R1911:Znrf1 UTSW 8 111621612 missense possibly damaging 0.92
R3754:Znrf1 UTSW 8 111619211 missense probably damaging 1.00
R4867:Znrf1 UTSW 8 111537566 critical splice donor site probably null
R5090:Znrf1 UTSW 8 111538403 missense probably benign 0.00
R5267:Znrf1 UTSW 8 111537267 missense probably benign 0.00
R5396:Znrf1 UTSW 8 111619194 splice site probably null
R7084:Znrf1 UTSW 8 111537142 start codon destroyed probably null 0.53
R7493:Znrf1 UTSW 8 111537439 missense probably damaging 1.00
R8507:Znrf1 UTSW 8 111537210 missense probably damaging 0.99
R8926:Znrf1 UTSW 8 111537511 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTCTTGAAAGATGACAGCTGTGG -3'
(R):5'- GGTTCCTCACATGCACATGC -3'

Sequencing Primer
(F):5'- GAAGGACAGATTGATCTCTGCTC -3'
(R):5'- CATGCACAGTGCTGCTAAAAG -3'
Posted On 2016-07-06