Incidental Mutation 'R5197:Olfr1000'
ID400313
Institutional Source Beutler Lab
Gene Symbol Olfr1000
Ensembl Gene ENSMUSG00000075215
Gene Nameolfactory receptor 1000
SynonymsMOR175-9, GA_x6K02T2Q125-47087719-47086775
MMRRC Submission 042773-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5197 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85607037-85611903 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85608447 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 154 (I154M)
Ref Sequence ENSEMBL: ENSMUSP00000150731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099921] [ENSMUST00000213837] [ENSMUST00000216571]
Predicted Effect probably benign
Transcript: ENSMUST00000099921
AA Change: I154M

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000097505
Gene: ENSMUSG00000075215
AA Change: I154M

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.1e-49 PFAM
Pfam:7tm_1 41 290 2.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213837
AA Change: I154M

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000216571
AA Change: I154M

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg1 T C 9: 54,622,582 E247G possibly damaging Het
Adgra3 A G 5: 49,960,754 F1151L probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Aldh4a1 A C 4: 139,648,301 probably benign Het
Anln A T 9: 22,352,781 probably null Het
Aste1 T C 9: 105,405,054 S74P probably damaging Het
Atp6v0e2 G A 6: 48,540,117 R77H probably benign Het
Brpf1 A G 6: 113,319,941 D962G possibly damaging Het
Btbd2 T C 10: 80,646,419 D249G probably damaging Het
Catsper3 T C 13: 55,808,176 probably null Het
Cfap43 A G 19: 47,897,372 L268P probably damaging Het
Cftr T C 6: 18,255,414 V540A probably benign Het
Col22a1 C T 15: 72,009,406 G32D probably damaging Het
Col5a2 G T 1: 45,393,081 P804Q probably benign Het
Cyp2d41-ps A G 15: 82,778,780 noncoding transcript Het
Cyp39a1 T G 17: 43,746,538 L423V possibly damaging Het
Elmo1 T G 13: 20,564,437 V484G probably benign Het
Eps8 C A 6: 137,490,290 Q656H probably damaging Het
Eps8 T C 6: 137,490,291 Q656R possibly damaging Het
Fam71f2 G T 6: 29,281,222 probably benign Het
Fshb T C 2: 107,057,509 D55G possibly damaging Het
Gm13089 A C 4: 143,698,062 C270W possibly damaging Het
Herc1 C A 9: 66,448,504 Q2346K probably damaging Het
Hist1h3d T A 13: 23,576,130 L110Q probably damaging Het
Htr3b T C 9: 48,945,515 D221G probably benign Het
Ift74 T A 4: 94,662,596 D328E probably benign Het
Kif21b A T 1: 136,144,625 K23M probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lipc T A 9: 70,798,391 E470V probably benign Het
Lrrc4 G T 6: 28,830,143 T68K probably damaging Het
Lrrc63 T A 14: 75,084,882 H594L possibly damaging Het
Mfsd14a A T 3: 116,648,501 probably benign Het
Mob2 T C 7: 142,009,537 probably null Het
Nckap5 T A 1: 126,222,673 H105L possibly damaging Het
Ngef C A 1: 87,509,368 G133* probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr113 T G 17: 37,575,220 I68L probably benign Het
Olfr1477 G T 19: 13,502,384 V14F possibly damaging Het
Olfr31 T A 14: 14,328,462 M117K probably damaging Het
Olfr593 G A 7: 103,212,000 V47I probably benign Het
Pard3 A G 8: 127,073,290 probably null Het
Pgm1 C T 5: 64,105,832 A274V possibly damaging Het
Ppp1r9a T A 6: 5,156,177 S1144R probably damaging Het
Prkcq C T 2: 11,299,416 P590L probably damaging Het
Psmd13 T A 7: 140,894,461 probably null Het
Rab3gap1 T A 1: 127,889,194 D63E probably benign Het
Rag2 C A 2: 101,630,740 T465K probably damaging Het
Rnase6 A G 14: 51,130,213 M21V unknown Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 A T 13: 11,638,430 probably null Het
Sash1 T G 10: 8,740,225 R624S probably damaging Het
Slc1a2 A G 2: 102,756,115 I355V probably benign Het
Srrm2 T C 17: 23,817,384 S1097P probably benign Het
Sugct C T 13: 17,323,276 A271T probably damaging Het
Tdrd7 T C 4: 46,034,350 V1065A probably damaging Het
Tmprss6 T A 15: 78,454,189 Y307F probably damaging Het
Tram1 T C 1: 13,571,902 N216S probably benign Het
Ttk T C 9: 83,839,341 V93A probably benign Het
Ubr4 A G 4: 139,468,097 Y1210C probably damaging Het
Wdr7 A G 18: 63,738,866 K364E probably benign Het
Xrcc2 G T 5: 25,692,658 H98N probably benign Het
Zdhhc11 A G 13: 73,965,569 I77V probably benign Het
Zfp54 C T 17: 21,434,180 S312L probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Olfr1000
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Olfr1000 APN 2 85608761 missense probably benign
IGL01872:Olfr1000 APN 2 85608329 missense probably benign
IGL01955:Olfr1000 APN 2 85608707 missense probably benign 0.12
IGL02132:Olfr1000 APN 2 85608320 missense probably benign 0.00
IGL02139:Olfr1000 APN 2 85608230 nonsense probably null
IGL02717:Olfr1000 APN 2 85608772 missense probably damaging 1.00
IGL02950:Olfr1000 APN 2 85608157 missense possibly damaging 0.92
R1866:Olfr1000 UTSW 2 85608844 missense probably benign 0.05
R1868:Olfr1000 UTSW 2 85608065 missense probably damaging 0.98
R1869:Olfr1000 UTSW 2 85608500 missense probably benign 0.23
R2256:Olfr1000 UTSW 2 85608463 missense possibly damaging 0.81
R2919:Olfr1000 UTSW 2 85608410 missense probably benign 0.06
R4736:Olfr1000 UTSW 2 85607983 missense probably benign
R5256:Olfr1000 UTSW 2 85608473 missense probably benign
R5367:Olfr1000 UTSW 2 85608374 missense probably damaging 0.99
R5389:Olfr1000 UTSW 2 85608283 missense probably benign
R6991:Olfr1000 UTSW 2 85608248 missense possibly damaging 0.76
R7017:Olfr1000 UTSW 2 85608329 missense probably benign
R7020:Olfr1000 UTSW 2 85608632 missense probably benign 0.11
R7352:Olfr1000 UTSW 2 85608784 missense probably damaging 1.00
R7392:Olfr1000 UTSW 2 85608488 missense possibly damaging 0.61
R7586:Olfr1000 UTSW 2 85608184 missense probably damaging 0.99
R7727:Olfr1000 UTSW 2 85608407 missense possibly damaging 0.72
R8053:Olfr1000 UTSW 2 85608890 missense probably damaging 0.98
R8108:Olfr1000 UTSW 2 85608749 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCAAGATGCATACATAGGACCC -3'
(R):5'- AAAGCCATCTCTTTTGTGGGC -3'

Sequencing Primer
(F):5'- GGACCCCAGAATTATCAGACCAGTG -3'
(R):5'- TGTGGGCTGTGCAACAC -3'
Posted On2016-07-06