Mutagenetix > Incidental Mutations

Incidental Mutation 'R5271:Ncoa7'

400321

Institutional Source

Beutler Lab

Gene Symbol

Ncoa7

Ensembl Gene

ENSMUSG00000039697

Gene Name

nuclear receptor coactivator 7

Synonyms

9030406N13Rik

MMRRC Submission

042861-MU

Accession Numbers

Genbank: NM_172495; MGI: 2444847

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5271 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30628999-30803326 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 30722729 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 66 (H66R)

Ref Sequence

ENSEMBL: ENSMUSP00000150021 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068567] [ENSMUST00000213836] [ENSMUST00000215725] [ENSMUST00000215740] [ENSMUST00000215926]

AlphaFold

Q6DFV7

Predicted Effect

probably benign
Transcript: ENSMUST00000068567
AA Change: H66R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000066741
Gene: ENSMUSG00000039697
AA Change: H66R

Domain	Start	End	E-Value	Type
coiled coil region	1	32	N/A	INTRINSIC
LysM	118	161	2.24e-7	SMART
low complexity region	165	176	N/A	INTRINSIC
TLDc	781	943	2.86e-64	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000213836
AA Change: H66R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

Predicted Effect

probably benign
Transcript: ENSMUST00000215725
AA Change: H66R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Predicted Effect

probably benign
Transcript: ENSMUST00000215740
AA Change: H66R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Predicted Effect

probably benign
Transcript: ENSMUST00000215926
AA Change: H66R

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

Predicted Effect

probably benign
Transcript: ENSMUST00000217398

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.6%
20x: 93.6%

Validation Efficiency

97% (65/67)

Allele List at MGI

All alleles(108) : Gene trapped(108)

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003H04Rik	T	C	3: 124,579,847	K33R	possibly damaging	Het
4632415L05Rik	C	T	3: 19,895,147		noncoding transcript	Het
4930542C16Rik	A	C	14: 24,615,530		noncoding transcript	Het
Adprh	A	T	16: 38,446,054	L242*	probably null	Het
Anapc1	G	A	2: 128,685,985	Q18*	probably null	Het
Bfar	T	C	16: 13,692,397		probably benign	Het
Bmp1	T	C	14: 70,508,128	I206V	probably benign	Het
Cc2d1b	T	A	4: 108,623,629		probably benign	Het
Clock	A	G	5: 76,241,954	I349T	probably damaging	Het
Cox11	A	G	11: 90,643,732	Y60C	probably damaging	Het
Cyp1a1	G	A	9: 57,702,838	V512M	probably benign	Het
Dcdc2a	T	C	13: 25,187,688	F311S	probably benign	Het
Dnase1l3	T	C	14: 7,993,843	D48G	probably damaging	Het
Engase	G	T	11: 118,481,397	A172S	probably damaging	Het
F2	T	C	2: 91,635,121		probably benign	Het
Gcc2	T	C	10: 58,269,695	V215A	possibly damaging	Het
Gm11677	C	T	11: 111,724,711		noncoding transcript	Het
Gm14548	A	T	7: 3,897,567	Y61*	probably null	Het
Gm20388	A	G	8: 122,271,133		probably benign	Het
Gm20671	T	C	5: 32,819,959	K1817R	possibly damaging	Het
Gm20939	T	A	17: 94,877,155	Y410*	probably null	Het
Gm27013	T	C	6: 130,676,915	Y528C	probably damaging	Het
Gm9992	T	C	17: 7,369,682	N149S	possibly damaging	Het
Il23r	T	C	6: 67,423,696	H550R	probably benign	Het
Iqgap1	A	T	7: 80,734,148	V1056E	probably damaging	Het
Lrit3	T	A	3: 129,788,301	Y679F	probably damaging	Het
Megf8	A	T	7: 25,341,706	E1120V	probably damaging	Het
Mta1	A	G	12: 113,131,957	E518G	probably damaging	Het
Myo9a	A	G	9: 59,907,382	I2200M	probably damaging	Het
Ncor1	A	G	11: 62,340,545	V812A	probably damaging	Het
Ndnf	T	C	6: 65,703,666	Y310H	possibly damaging	Het
Ndst1	G	A	18: 60,705,132	T347I	probably benign	Het
Olfr1229	A	T	2: 89,282,953	F60Y	probably benign	Het
Olfr512	T	C	7: 108,714,217	L276S	probably damaging	Het
Pcdhb10	C	A	18: 37,413,169	Q433K	probably benign	Het
Pcdhb18	G	A	18: 37,491,596	V660M	possibly damaging	Het
Pds5b	T	A	5: 150,723,353	N202K	possibly damaging	Het
Polk	T	C	13: 96,483,539	S718G	probably benign	Het
Ptpdc1	T	C	13: 48,590,698	D149G	probably damaging	Het
Rb1cc1	T	A	1: 6,249,193	C35*	probably null	Het
Samd9l	C	T	6: 3,376,156	M368I	probably benign	Het
Shroom3	T	C	5: 92,962,248	M1739T	probably damaging	Het
Slc18a3	A	G	14: 32,463,748	L226P	probably damaging	Het
St7l	A	T	3: 104,868,060	Y84F	probably damaging	Het
Svil	A	T	18: 5,062,329	N392I	probably benign	Het
Syngr1	T	A	15: 80,098,039	M9K	probably benign	Het
Taar2	T	C	10: 23,941,032	S157P	probably damaging	Het
Tagap1	G	T	17: 6,956,096	Y400*	probably null	Het
Tbc1d8	T	A	1: 39,373,767	E976V	probably damaging	Het
Tmem163	G	A	1: 127,491,552		probably benign	Het
Tnfaip2	A	G	12: 111,448,460		probably benign	Het
Ttn	C	T	2: 76,706,517	S34988N	possibly damaging	Het
Tubg1	T	G	11: 101,120,238	N15K	probably damaging	Het
Vmn2r-ps159	G	T	4: 156,334,397		noncoding transcript	Het
Zap70	T	A	1: 36,781,365	V547D	probably damaging	Het
Zfp146	G	T	7: 30,162,475	N47K	probably benign	Het
Znrf1	T	G	8: 111,609,344	M159R	probably benign	Het

Other mutations in Ncoa7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01406:Ncoa7	APN	10	30690840	missense	probably damaging	1.00
IGL01716:Ncoa7	APN	10	30662334	missense	probably damaging	0.96
IGL02114:Ncoa7	APN	10	30662364	missense	probably damaging	1.00
IGL02170:Ncoa7	APN	10	30689853	missense	possibly damaging	0.94
IGL02436:Ncoa7	APN	10	30694147	missense	probably damaging	1.00
IGL02499:Ncoa7	APN	10	30690889	missense	probably benign	0.04
IGL02533:Ncoa7	APN	10	30690899	missense	possibly damaging	0.87
IGL02533:Ncoa7	APN	10	30722785	missense	probably damaging	1.00
IGL02590:Ncoa7	APN	10	30694163	missense	probably damaging	1.00
IGL02657:Ncoa7	APN	10	30652976	missense	probably damaging	1.00
IGL03065:Ncoa7	APN	10	30647997	missense	probably damaging	1.00
IGL03088:Ncoa7	APN	10	30698125	splice site	probably null
IGL03090:Ncoa7	APN	10	30662400	missense	probably damaging	0.96
IGL03196:Ncoa7	APN	10	30647514	utr 3 prime	probably benign
D6062:Ncoa7	UTSW	10	30722655	missense	probably damaging	1.00
R0058:Ncoa7	UTSW	10	30647541	missense	probably damaging	1.00
R0058:Ncoa7	UTSW	10	30647541	missense	probably damaging	1.00
R0578:Ncoa7	UTSW	10	30701917	critical splice donor site	probably null
R0729:Ncoa7	UTSW	10	30691579	missense	probably benign	0.00
R1538:Ncoa7	UTSW	10	30694211	missense	probably damaging	0.99
R1539:Ncoa7	UTSW	10	30771729	missense	probably damaging	1.00
R1574:Ncoa7	UTSW	10	30694101	missense	probably damaging	1.00
R1574:Ncoa7	UTSW	10	30694101	missense	probably damaging	1.00
R1624:Ncoa7	UTSW	10	30704659	missense	possibly damaging	0.87
R1639:Ncoa7	UTSW	10	30701992	missense	probably damaging	1.00
R1655:Ncoa7	UTSW	10	30698245	critical splice acceptor site	probably null
R1876:Ncoa7	UTSW	10	30698126	intron	probably benign
R1885:Ncoa7	UTSW	10	30648452	missense	possibly damaging	0.81
R1886:Ncoa7	UTSW	10	30648452	missense	possibly damaging	0.81
R1887:Ncoa7	UTSW	10	30648452	missense	possibly damaging	0.81
R1909:Ncoa7	UTSW	10	30689800	missense	probably damaging	1.00
R1938:Ncoa7	UTSW	10	30698170	missense	probably benign	0.02
R1965:Ncoa7	UTSW	10	30654430	nonsense	probably null
R1978:Ncoa7	UTSW	10	30691299	missense	probably benign
R2303:Ncoa7	UTSW	10	30654435	missense	probably damaging	1.00
R3777:Ncoa7	UTSW	10	30689756	missense	probably damaging	1.00
R3778:Ncoa7	UTSW	10	30689756	missense	probably damaging	1.00
R4026:Ncoa7	UTSW	10	30722724	missense	probably benign	0.02
R4230:Ncoa7	UTSW	10	30698257	splice site	probably null
R4667:Ncoa7	UTSW	10	30690790	missense	probably damaging	1.00
R4786:Ncoa7	UTSW	10	30655642	missense	probably benign	0.28
R4809:Ncoa7	UTSW	10	30771762	missense	possibly damaging	0.92
R4820:Ncoa7	UTSW	10	30648476	missense	probably damaging	1.00
R4839:Ncoa7	UTSW	10	30722659	missense	possibly damaging	0.93
R4861:Ncoa7	UTSW	10	30704612	missense	probably benign
R4861:Ncoa7	UTSW	10	30704612	missense	probably benign
R5384:Ncoa7	UTSW	10	30722817	missense	probably benign	0.00
R5418:Ncoa7	UTSW	10	30648039	missense	probably damaging	1.00
R5964:Ncoa7	UTSW	10	30704636	missense	probably damaging	1.00
R6257:Ncoa7	UTSW	10	30694177	missense	probably damaging	1.00
R6683:Ncoa7	UTSW	10	30771721	missense	probably damaging	0.99
R6813:Ncoa7	UTSW	10	30696192	missense	probably damaging	1.00
R6910:Ncoa7	UTSW	10	30694121	missense	possibly damaging	0.89
R7123:Ncoa7	UTSW	10	30654439	missense	probably benign	0.28
R7327:Ncoa7	UTSW	10	30689800	missense	probably damaging	1.00
R7412:Ncoa7	UTSW	10	30722851	missense	possibly damaging	0.94
R7638:Ncoa7	UTSW	10	30722798	missense	probably benign	0.35
R7653:Ncoa7	UTSW	10	30694243	missense	probably damaging	1.00
R7848:Ncoa7	UTSW	10	30648418	missense	possibly damaging	0.82
R7861:Ncoa7	UTSW	10	30691060	missense	probably benign	0.38
R8125:Ncoa7	UTSW	10	30694091	missense	possibly damaging	0.80
R8198:Ncoa7	UTSW	10	30704668	missense	probably benign	0.00
R8240:Ncoa7	UTSW	10	30691729	missense	probably benign	0.45
R8353:Ncoa7	UTSW	10	30694159	missense	probably damaging	1.00
R8509:Ncoa7	UTSW	10	30696052	missense	probably benign	0.00
R8861:Ncoa7	UTSW	10	30691368	missense	probably benign	0.02
R9040:Ncoa7	UTSW	10	30654393	missense	probably benign	0.00
R9136:Ncoa7	UTSW	10	30691632	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GACAGGGCCTTAGTAACCTG -3'
(R):5'- TAGGATGGCATGTAACAACTTTCC -3'

Sequencing Primer
(F):5'- AGTAACCTGGGCTGGCTTC -3'
(R):5'- GGCATGTAACAACTTTCCCCCTTTTC -3'

Posted On

2016-07-06