Incidental Mutation 'R5197:Tdrd7'
ID400322
Institutional Source Beutler Lab
Gene Symbol Tdrd7
Ensembl Gene ENSMUSG00000035517
Gene Nametudor domain containing 7
Synonyms5730495N10Rik
MMRRC Submission 042773-MU
Accession Numbers

Genbank: NM_146142; MGI: 2140279

Is this an essential gene? Possibly non essential (E-score: 0.483) question?
Stock #R5197 (G1)
Quality Score176
Status Validated
Chromosome4
Chromosomal Location45965334-46034761 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46034350 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1065 (V1065A)
Ref Sequence ENSEMBL: ENSMUSP00000103406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102929] [ENSMUST00000107773] [ENSMUST00000107777] [ENSMUST00000156200]
Predicted Effect probably damaging
Transcript: ENSMUST00000102929
AA Change: V1032A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099993
Gene: ENSMUSG00000035517
AA Change: V1032A

DomainStartEndE-ValueType
Pfam:OST-HTH 3 73 2.6e-10 PFAM
internal_repeat_1 223 300 2.94e-9 PROSPERO
low complexity region 302 318 N/A INTRINSIC
internal_repeat_1 326 400 2.94e-9 PROSPERO
TUDOR 500 556 2.08e-5 SMART
TUDOR 690 746 1.66e-4 SMART
TUDOR 945 1001 4.03e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107773
SMART Domains Protein: ENSMUSP00000103402
Gene: ENSMUSG00000028328

DomainStartEndE-ValueType
Pfam:Tropomodulin 3 143 6.3e-64 PFAM
PDB:1IO0|A 160 344 1e-115 PDB
SCOP:d1a4ya_ 181 312 3e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107777
AA Change: V1065A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103406
Gene: ENSMUSG00000035517
AA Change: V1065A

DomainStartEndE-ValueType
Pfam:OST-HTH 36 106 5.7e-11 PFAM
internal_repeat_1 256 333 3.1e-9 PROSPERO
low complexity region 335 351 N/A INTRINSIC
internal_repeat_1 359 433 3.1e-9 PROSPERO
TUDOR 533 589 2.08e-5 SMART
TUDOR 723 779 1.66e-4 SMART
TUDOR 978 1034 4.03e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155936
Predicted Effect probably benign
Transcript: ENSMUST00000156200
Meta Mutation Damage Score 0.5122 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Tudor family of proteins. This protein contains conserved Tudor domains and LOTUS domains. It is a component of RNA granules, which function in RNA processing. Mutations in this gene have been associated with cataract formation in mouse and human. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous inactivation of this gene causes arrest of spermatogenesis, male sterility, glaucoma, and cataracts. Aging mice homozygous for an ENU-induced (null) allele show additional ocular phenotypes including an enlarged anterior chamber, lens extrusion, a flat iris, uveitis, and optic neuropathy. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg1 T C 9: 54,622,582 E247G possibly damaging Het
Adgra3 A G 5: 49,960,754 F1151L probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Aldh4a1 A C 4: 139,648,301 probably benign Het
Anln A T 9: 22,352,781 probably null Het
Aste1 T C 9: 105,405,054 S74P probably damaging Het
Atp6v0e2 G A 6: 48,540,117 R77H probably benign Het
Brpf1 A G 6: 113,319,941 D962G possibly damaging Het
Btbd2 T C 10: 80,646,419 D249G probably damaging Het
Catsper3 T C 13: 55,808,176 probably null Het
Cfap43 A G 19: 47,897,372 L268P probably damaging Het
Cftr T C 6: 18,255,414 V540A probably benign Het
Col22a1 C T 15: 72,009,406 G32D probably damaging Het
Col5a2 G T 1: 45,393,081 P804Q probably benign Het
Cyp2d41-ps A G 15: 82,778,780 noncoding transcript Het
Cyp39a1 T G 17: 43,746,538 L423V possibly damaging Het
Elmo1 T G 13: 20,564,437 V484G probably benign Het
Eps8 C A 6: 137,490,290 Q656H probably damaging Het
Eps8 T C 6: 137,490,291 Q656R possibly damaging Het
Fam71f2 G T 6: 29,281,222 probably benign Het
Fshb T C 2: 107,057,509 D55G possibly damaging Het
Gm13089 A C 4: 143,698,062 C270W possibly damaging Het
Herc1 C A 9: 66,448,504 Q2346K probably damaging Het
Hist1h3d T A 13: 23,576,130 L110Q probably damaging Het
Htr3b T C 9: 48,945,515 D221G probably benign Het
Ift74 T A 4: 94,662,596 D328E probably benign Het
Kif21b A T 1: 136,144,625 K23M probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lipc T A 9: 70,798,391 E470V probably benign Het
Lrrc4 G T 6: 28,830,143 T68K probably damaging Het
Lrrc63 T A 14: 75,084,882 H594L possibly damaging Het
Mfsd14a A T 3: 116,648,501 probably benign Het
Mob2 T C 7: 142,009,537 probably null Het
Nckap5 T A 1: 126,222,673 H105L possibly damaging Het
Ngef C A 1: 87,509,368 G133* probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1000 T C 2: 85,608,447 I154M probably benign Het
Olfr113 T G 17: 37,575,220 I68L probably benign Het
Olfr1477 G T 19: 13,502,384 V14F possibly damaging Het
Olfr31 T A 14: 14,328,462 M117K probably damaging Het
Olfr593 G A 7: 103,212,000 V47I probably benign Het
Pard3 A G 8: 127,073,290 probably null Het
Pgm1 C T 5: 64,105,832 A274V possibly damaging Het
Ppp1r9a T A 6: 5,156,177 S1144R probably damaging Het
Prkcq C T 2: 11,299,416 P590L probably damaging Het
Psmd13 T A 7: 140,894,461 probably null Het
Rab3gap1 T A 1: 127,889,194 D63E probably benign Het
Rag2 C A 2: 101,630,740 T465K probably damaging Het
Rnase6 A G 14: 51,130,213 M21V unknown Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 A T 13: 11,638,430 probably null Het
Sash1 T G 10: 8,740,225 R624S probably damaging Het
Slc1a2 A G 2: 102,756,115 I355V probably benign Het
Srrm2 T C 17: 23,817,384 S1097P probably benign Het
Sugct C T 13: 17,323,276 A271T probably damaging Het
Tmprss6 T A 15: 78,454,189 Y307F probably damaging Het
Tram1 T C 1: 13,571,902 N216S probably benign Het
Ttk T C 9: 83,839,341 V93A probably benign Het
Ubr4 A G 4: 139,468,097 Y1210C probably damaging Het
Wdr7 A G 18: 63,738,866 K364E probably benign Het
Xrcc2 G T 5: 25,692,658 H98N probably benign Het
Zdhhc11 A G 13: 73,965,569 I77V probably benign Het
Zfp54 C T 17: 21,434,180 S312L probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Tdrd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Tdrd7 APN 4 46010889 missense probably damaging 1.00
IGL01541:Tdrd7 APN 4 46018551 missense possibly damaging 0.90
IGL01901:Tdrd7 APN 4 45989225 splice site probably benign
IGL02812:Tdrd7 APN 4 45994406 missense probably benign 0.08
A5278:Tdrd7 UTSW 4 46007622 missense probably benign 0.01
R0049:Tdrd7 UTSW 4 45987582 missense probably damaging 1.00
R0049:Tdrd7 UTSW 4 45987582 missense probably damaging 1.00
R0389:Tdrd7 UTSW 4 46016987 missense probably benign 0.01
R0452:Tdrd7 UTSW 4 45965488 splice site probably benign
R0639:Tdrd7 UTSW 4 45989102 missense probably benign 0.00
R0681:Tdrd7 UTSW 4 46016879 missense probably benign 0.45
R0925:Tdrd7 UTSW 4 46025758 missense probably damaging 1.00
R0944:Tdrd7 UTSW 4 46029762 missense probably benign 0.01
R1586:Tdrd7 UTSW 4 45994445 missense probably benign 0.39
R1770:Tdrd7 UTSW 4 45987681 splice site probably benign
R1945:Tdrd7 UTSW 4 45965474 missense probably benign 0.00
R4400:Tdrd7 UTSW 4 46005540 missense possibly damaging 0.87
R4457:Tdrd7 UTSW 4 46007526 missense probably benign 0.04
R4898:Tdrd7 UTSW 4 46005616 missense possibly damaging 0.94
R5152:Tdrd7 UTSW 4 46013191 missense probably damaging 1.00
R5326:Tdrd7 UTSW 4 46029757 missense probably benign 0.01
R5473:Tdrd7 UTSW 4 46020877 missense possibly damaging 0.95
R5524:Tdrd7 UTSW 4 46034301 missense probably benign 0.31
R5542:Tdrd7 UTSW 4 46029757 missense probably benign 0.01
R5554:Tdrd7 UTSW 4 46005358 missense possibly damaging 0.92
R5588:Tdrd7 UTSW 4 45992225 missense probably benign 0.18
R5776:Tdrd7 UTSW 4 46005689 missense probably benign 0.00
R5786:Tdrd7 UTSW 4 45989082 missense probably benign 0.09
R6063:Tdrd7 UTSW 4 46005486 missense probably benign 0.00
R6340:Tdrd7 UTSW 4 45994517 missense probably damaging 0.99
R7130:Tdrd7 UTSW 4 46029693 missense probably damaging 1.00
R7369:Tdrd7 UTSW 4 46013239 missense possibly damaging 0.79
R7470:Tdrd7 UTSW 4 45990144 missense probably benign 0.32
R7876:Tdrd7 UTSW 4 46025684 missense probably benign
R7999:Tdrd7 UTSW 4 46010902 critical splice donor site probably null
R8042:Tdrd7 UTSW 4 45987516 missense possibly damaging 0.71
R8058:Tdrd7 UTSW 4 46034309 missense probably benign 0.34
R8532:Tdrd7 UTSW 4 46016920 missense probably damaging 0.98
R8771:Tdrd7 UTSW 4 46010800 missense probably damaging 1.00
X0063:Tdrd7 UTSW 4 45992268 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCACGATAGACAAGCTGTGAG -3'
(R):5'- TAGCGGTCAACATCTCAAGCAG -3'

Sequencing Primer
(F):5'- GGCTGCTATTCTCTGCCGTAG -3'
(R):5'- GCAGTGATTAATTAACTTTCGAAAGC -3'
Posted On2016-07-06