Incidental Mutation 'R5271:Ncor1'
ID 400325
Institutional Source Beutler Lab
Gene Symbol Ncor1
Ensembl Gene ENSMUSG00000018501
Gene Name nuclear receptor co-repressor 1
Synonyms 5730405M06Rik, A230020K14Rik, Rxrip13, N-CoR
MMRRC Submission 042861-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5271 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 62316426-62458541 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 62340545 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 812 (V812A)
Ref Sequence ENSEMBL: ENSMUSP00000122654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018645] [ENSMUST00000037575] [ENSMUST00000101066] [ENSMUST00000101067] [ENSMUST00000151498] [ENSMUST00000155712]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000018645
AA Change: V1543A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000018645
Gene: ENSMUSG00000018501
AA Change: V1543A

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
Pfam:GPS2_interact 150 239 1.4e-37 PFAM
coiled coil region 302 329 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
SANT 437 485 2.76e-7 SMART
coiled coil region 507 544 N/A INTRINSIC
low complexity region 593 617 N/A INTRINSIC
SANT 624 672 3.29e-14 SMART
low complexity region 710 731 N/A INTRINSIC
low complexity region 771 788 N/A INTRINSIC
low complexity region 888 899 N/A INTRINSIC
low complexity region 987 995 N/A INTRINSIC
low complexity region 1002 1013 N/A INTRINSIC
low complexity region 1036 1049 N/A INTRINSIC
internal_repeat_2 1061 1298 1.62e-6 PROSPERO
internal_repeat_2 1299 1515 1.62e-6 PROSPERO
low complexity region 1516 1527 N/A INTRINSIC
coiled coil region 1712 1749 N/A INTRINSIC
low complexity region 1834 1848 N/A INTRINSIC
low complexity region 1969 1980 N/A INTRINSIC
low complexity region 2036 2055 N/A INTRINSIC
PDB:3N00|B 2064 2084 4e-7 PDB
low complexity region 2086 2101 N/A INTRINSIC
low complexity region 2157 2168 N/A INTRINSIC
PDB:2OVM|B 2267 2290 2e-8 PDB
low complexity region 2311 2324 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000037575
AA Change: V488A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038900
Gene: ENSMUSG00000018501
AA Change: V488A

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 461 472 N/A INTRINSIC
coiled coil region 658 695 N/A INTRINSIC
low complexity region 780 794 N/A INTRINSIC
low complexity region 915 926 N/A INTRINSIC
low complexity region 982 1001 N/A INTRINSIC
PDB:3N00|B 1010 1030 2e-7 PDB
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
PDB:2OVM|B 1212 1235 2e-8 PDB
low complexity region 1256 1269 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101066
AA Change: V1543A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098627
Gene: ENSMUSG00000018501
AA Change: V1543A

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
coiled coil region 176 217 N/A INTRINSIC
coiled coil region 302 329 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
SANT 437 485 2.76e-7 SMART
coiled coil region 507 544 N/A INTRINSIC
low complexity region 593 617 N/A INTRINSIC
SANT 624 672 3.29e-14 SMART
low complexity region 710 731 N/A INTRINSIC
low complexity region 771 788 N/A INTRINSIC
low complexity region 888 899 N/A INTRINSIC
low complexity region 987 995 N/A INTRINSIC
low complexity region 1002 1013 N/A INTRINSIC
low complexity region 1036 1049 N/A INTRINSIC
internal_repeat_2 1061 1298 1.62e-6 PROSPERO
internal_repeat_2 1299 1515 1.62e-6 PROSPERO
low complexity region 1516 1527 N/A INTRINSIC
coiled coil region 1712 1749 N/A INTRINSIC
low complexity region 1834 1848 N/A INTRINSIC
low complexity region 1969 1980 N/A INTRINSIC
low complexity region 2036 2055 N/A INTRINSIC
PDB:3N00|B 2064 2084 4e-7 PDB
low complexity region 2086 2101 N/A INTRINSIC
low complexity region 2157 2168 N/A INTRINSIC
PDB:2OVM|B 2267 2290 2e-8 PDB
low complexity region 2311 2324 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101067
AA Change: V1475A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098628
Gene: ENSMUSG00000018501
AA Change: V1475A

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
coiled coil region 176 217 N/A INTRINSIC
coiled coil region 302 329 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
SANT 437 485 2.76e-7 SMART
coiled coil region 507 544 N/A INTRINSIC
low complexity region 593 617 N/A INTRINSIC
SANT 624 672 3.29e-14 SMART
low complexity region 716 734 N/A INTRINSIC
low complexity region 838 849 N/A INTRINSIC
low complexity region 937 945 N/A INTRINSIC
low complexity region 952 963 N/A INTRINSIC
low complexity region 986 999 N/A INTRINSIC
low complexity region 1448 1459 N/A INTRINSIC
coiled coil region 1645 1682 N/A INTRINSIC
low complexity region 1767 1781 N/A INTRINSIC
low complexity region 1902 1913 N/A INTRINSIC
low complexity region 1969 1988 N/A INTRINSIC
PDB:3N00|B 1997 2017 4e-7 PDB
low complexity region 2019 2034 N/A INTRINSIC
low complexity region 2089 2100 N/A INTRINSIC
PDB:2OVM|B 2199 2222 2e-8 PDB
low complexity region 2243 2256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151498
SMART Domains Protein: ENSMUSP00000125317
Gene: ENSMUSG00000018501

DomainStartEndE-ValueType
SANT 37 85 2.76e-7 SMART
coiled coil region 107 144 N/A INTRINSIC
low complexity region 193 217 N/A INTRINSIC
SANT 224 272 3.29e-14 SMART
low complexity region 316 337 N/A INTRINSIC
low complexity region 361 378 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 577 585 N/A INTRINSIC
low complexity region 592 603 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
internal_repeat_2 700 830 5.77e-7 PROSPERO
internal_repeat_2 855 961 5.77e-7 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000155712
AA Change: V812A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122654
Gene: ENSMUSG00000018501
AA Change: V812A

DomainStartEndE-ValueType
low complexity region 26 47 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
low complexity region 303 311 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 352 365 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
coiled coil region 982 1019 N/A INTRINSIC
low complexity region 1104 1118 N/A INTRINSIC
low complexity region 1239 1250 N/A INTRINSIC
low complexity region 1306 1325 N/A INTRINSIC
PDB:3N00|B 1334 1354 3e-7 PDB
low complexity region 1356 1371 N/A INTRINSIC
low complexity region 1427 1438 N/A INTRINSIC
PDB:2OVM|B 1537 1560 2e-8 PDB
low complexity region 1581 1594 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000156740
AA Change: V477A
SMART Domains Protein: ENSMUSP00000125458
Gene: ENSMUSG00000018501
AA Change: V477A

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
coiled coil region 647 684 N/A INTRINSIC
low complexity region 770 784 N/A INTRINSIC
low complexity region 905 916 N/A INTRINSIC
low complexity region 972 991 N/A INTRINSIC
PDB:3N00|B 1000 1020 2e-7 PDB
low complexity region 1022 1037 N/A INTRINSIC
low complexity region 1092 1103 N/A INTRINSIC
PDB:2OVM|B 1202 1225 2e-8 PDB
low complexity region 1246 1259 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159224
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161432
Meta Mutation Damage Score 0.0711 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that mediates ligand-independent transcription repression of thyroid-hormone and retinoic-acid receptors by promoting chromatin condensation and preventing access of the transcription machinery. It is part of a complex which also includes histone deacetylases and transcriptional regulators similar to the yeast protein Sin3p. This gene is located between the Charcot-Marie-Tooth and Smith-Magenis syndrome critical regions on chromosome 17. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 17 and 20.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene exhibit embryonic lethality with erythrocytic, thymocytic and central nervous system development abnormalities. Mice homozygous for a hypomorphic allele exhibit increased thyroid hormone sensitivity under hypothyroid conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T C 3: 124,579,847 K33R possibly damaging Het
4632415L05Rik C T 3: 19,895,147 noncoding transcript Het
4930542C16Rik A C 14: 24,615,530 noncoding transcript Het
Adprh A T 16: 38,446,054 L242* probably null Het
Anapc1 G A 2: 128,685,985 Q18* probably null Het
Bfar T C 16: 13,692,397 probably benign Het
Bmp1 T C 14: 70,508,128 I206V probably benign Het
Cc2d1b T A 4: 108,623,629 probably benign Het
Clock A G 5: 76,241,954 I349T probably damaging Het
Cox11 A G 11: 90,643,732 Y60C probably damaging Het
Cyp1a1 G A 9: 57,702,838 V512M probably benign Het
Dcdc2a T C 13: 25,187,688 F311S probably benign Het
Dnase1l3 T C 14: 7,993,843 D48G probably damaging Het
Engase G T 11: 118,481,397 A172S probably damaging Het
F2 T C 2: 91,635,121 probably benign Het
Gcc2 T C 10: 58,269,695 V215A possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm14548 A T 7: 3,897,567 Y61* probably null Het
Gm20388 A G 8: 122,271,133 probably benign Het
Gm20671 T C 5: 32,819,959 K1817R possibly damaging Het
Gm20939 T A 17: 94,877,155 Y410* probably null Het
Gm27013 T C 6: 130,676,915 Y528C probably damaging Het
Gm9992 T C 17: 7,369,682 N149S possibly damaging Het
Il23r T C 6: 67,423,696 H550R probably benign Het
Iqgap1 A T 7: 80,734,148 V1056E probably damaging Het
Lrit3 T A 3: 129,788,301 Y679F probably damaging Het
Megf8 A T 7: 25,341,706 E1120V probably damaging Het
Mta1 A G 12: 113,131,957 E518G probably damaging Het
Myo9a A G 9: 59,907,382 I2200M probably damaging Het
Ncoa7 T C 10: 30,722,729 H66R probably benign Het
Ndnf T C 6: 65,703,666 Y310H possibly damaging Het
Ndst1 G A 18: 60,705,132 T347I probably benign Het
Olfr1229 A T 2: 89,282,953 F60Y probably benign Het
Olfr512 T C 7: 108,714,217 L276S probably damaging Het
Pcdhb10 C A 18: 37,413,169 Q433K probably benign Het
Pcdhb18 G A 18: 37,491,596 V660M possibly damaging Het
Pds5b T A 5: 150,723,353 N202K possibly damaging Het
Polk T C 13: 96,483,539 S718G probably benign Het
Ptpdc1 T C 13: 48,590,698 D149G probably damaging Het
Rb1cc1 T A 1: 6,249,193 C35* probably null Het
Samd9l C T 6: 3,376,156 M368I probably benign Het
Shroom3 T C 5: 92,962,248 M1739T probably damaging Het
Slc18a3 A G 14: 32,463,748 L226P probably damaging Het
St7l A T 3: 104,868,060 Y84F probably damaging Het
Svil A T 18: 5,062,329 N392I probably benign Het
Syngr1 T A 15: 80,098,039 M9K probably benign Het
Taar2 T C 10: 23,941,032 S157P probably damaging Het
Tagap1 G T 17: 6,956,096 Y400* probably null Het
Tbc1d8 T A 1: 39,373,767 E976V probably damaging Het
Tmem163 G A 1: 127,491,552 probably benign Het
Tnfaip2 A G 12: 111,448,460 probably benign Het
Ttn C T 2: 76,706,517 S34988N possibly damaging Het
Tubg1 T G 11: 101,120,238 N15K probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zap70 T A 1: 36,781,365 V547D probably damaging Het
Zfp146 G T 7: 30,162,475 N47K probably benign Het
Znrf1 T G 8: 111,609,344 M159R probably benign Het
Other mutations in Ncor1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Ncor1 APN 11 62392528 missense probably damaging 1.00
IGL01343:Ncor1 APN 11 62325486 critical splice donor site probably null
IGL01392:Ncor1 APN 11 62340594 missense probably damaging 0.99
IGL01402:Ncor1 APN 11 62340474 missense probably damaging 1.00
IGL01714:Ncor1 APN 11 62334584 missense possibly damaging 0.58
IGL01772:Ncor1 APN 11 62349347 intron probably benign
IGL01889:Ncor1 APN 11 62334601 missense possibly damaging 0.69
IGL02058:Ncor1 APN 11 62344637 missense probably damaging 1.00
IGL02065:Ncor1 APN 11 62419609 missense possibly damaging 0.95
IGL02073:Ncor1 APN 11 62358917 missense probably damaging 0.99
IGL02176:Ncor1 APN 11 62329659 unclassified probably benign
IGL02288:Ncor1 APN 11 62349403 missense probably benign 0.01
IGL02348:Ncor1 APN 11 62333659 splice site probably benign
IGL02608:Ncor1 APN 11 62373214 missense probably benign 0.07
laggard UTSW 11 62369304 missense probably damaging 1.00
Shortstep UTSW 11 62334541 missense probably damaging 1.00
LCD18:Ncor1 UTSW 11 62419782 critical splice acceptor site probably benign
PIT4382001:Ncor1 UTSW 11 62344663 missense probably damaging 0.96
PIT4576001:Ncor1 UTSW 11 62333717 missense probably damaging 0.99
R0026:Ncor1 UTSW 11 62438429 missense probably damaging 1.00
R0038:Ncor1 UTSW 11 62392551 missense probably damaging 0.99
R0038:Ncor1 UTSW 11 62392551 missense probably damaging 0.99
R0103:Ncor1 UTSW 11 62343045 missense possibly damaging 0.85
R0103:Ncor1 UTSW 11 62343045 missense possibly damaging 0.85
R0144:Ncor1 UTSW 11 62392595 missense probably damaging 1.00
R0427:Ncor1 UTSW 11 62410920 missense probably damaging 1.00
R0501:Ncor1 UTSW 11 62373322 missense possibly damaging 0.73
R0544:Ncor1 UTSW 11 62333776 missense probably damaging 1.00
R0544:Ncor1 UTSW 11 62333777 missense probably damaging 1.00
R0563:Ncor1 UTSW 11 62343230 missense probably damaging 0.97
R1074:Ncor1 UTSW 11 62392551 missense probably damaging 0.99
R1266:Ncor1 UTSW 11 62334040 missense probably damaging 0.98
R1444:Ncor1 UTSW 11 62403806 missense probably damaging 1.00
R1452:Ncor1 UTSW 11 62334631 missense probably damaging 1.00
R1534:Ncor1 UTSW 11 62378504 missense possibly damaging 0.92
R1710:Ncor1 UTSW 11 62423005 missense probably damaging 1.00
R1762:Ncor1 UTSW 11 62384784 missense possibly damaging 0.82
R1771:Ncor1 UTSW 11 62327112 missense probably damaging 1.00
R1864:Ncor1 UTSW 11 62381419 missense probably damaging 1.00
R1902:Ncor1 UTSW 11 62338158 missense probably damaging 1.00
R1906:Ncor1 UTSW 11 62349385 missense possibly damaging 0.81
R2009:Ncor1 UTSW 11 62325601 missense probably benign 0.43
R3708:Ncor1 UTSW 11 62344687 missense probably damaging 1.00
R3825:Ncor1 UTSW 11 62373357 missense probably benign 0.00
R3923:Ncor1 UTSW 11 62325616 missense probably damaging 1.00
R3966:Ncor1 UTSW 11 62344757 missense probably damaging 1.00
R4049:Ncor1 UTSW 11 62329668 splice site probably null
R4350:Ncor1 UTSW 11 62410818 critical splice donor site probably null
R4351:Ncor1 UTSW 11 62410818 critical splice donor site probably null
R4359:Ncor1 UTSW 11 62358910 missense probably damaging 1.00
R4712:Ncor1 UTSW 11 62344834 missense probably damaging 1.00
R4723:Ncor1 UTSW 11 62378612 missense probably benign 0.26
R4863:Ncor1 UTSW 11 62392638 missense possibly damaging 0.92
R4875:Ncor1 UTSW 11 62433611 small deletion probably benign
R4956:Ncor1 UTSW 11 62340605 missense probably damaging 1.00
R4993:Ncor1 UTSW 11 62343341 missense probably damaging 1.00
R5079:Ncor1 UTSW 11 62345237 missense possibly damaging 0.92
R5144:Ncor1 UTSW 11 62349464 missense probably damaging 1.00
R5223:Ncor1 UTSW 11 62339000 missense probably damaging 1.00
R5243:Ncor1 UTSW 11 62338962 missense probably damaging 1.00
R5285:Ncor1 UTSW 11 62392649 missense probably damaging 1.00
R5533:Ncor1 UTSW 11 62343011 missense probably benign 0.00
R5580:Ncor1 UTSW 11 62389778 nonsense probably null
R5593:Ncor1 UTSW 11 62369304 missense probably damaging 1.00
R5609:Ncor1 UTSW 11 62358853 splice site probably null
R5632:Ncor1 UTSW 11 62338234 missense possibly damaging 0.85
R5830:Ncor1 UTSW 11 62344763 missense possibly damaging 0.71
R5896:Ncor1 UTSW 11 62383190 missense probably damaging 1.00
R5973:Ncor1 UTSW 11 62349310 splice site probably null
R6013:Ncor1 UTSW 11 62321077 missense probably benign
R6019:Ncor1 UTSW 11 62373161 missense probably benign 0.00
R6032:Ncor1 UTSW 11 62373321 missense possibly damaging 0.54
R6032:Ncor1 UTSW 11 62373321 missense possibly damaging 0.54
R6075:Ncor1 UTSW 11 62317849 missense probably damaging 1.00
R6091:Ncor1 UTSW 11 62419617 missense probably damaging 0.98
R6248:Ncor1 UTSW 11 62366982 missense probably damaging 1.00
R6281:Ncor1 UTSW 11 62373545 missense possibly damaging 0.71
R6351:Ncor1 UTSW 11 62373298 missense probably benign 0.30
R6469:Ncor1 UTSW 11 62343302 missense probably damaging 1.00
R6502:Ncor1 UTSW 11 62381414 nonsense probably null
R6614:Ncor1 UTSW 11 62330819 missense probably benign 0.01
R6650:Ncor1 UTSW 11 62334541 missense probably damaging 1.00
R6765:Ncor1 UTSW 11 62373446 missense probably benign 0.01
R6852:Ncor1 UTSW 11 62343245 missense probably damaging 0.97
R6909:Ncor1 UTSW 11 62329486 missense probably damaging 1.00
R6965:Ncor1 UTSW 11 62353233 critical splice donor site probably null
R7054:Ncor1 UTSW 11 62384793 missense probably null
R7248:Ncor1 UTSW 11 62384772 missense possibly damaging 0.89
R7352:Ncor1 UTSW 11 62333911 missense probably damaging 0.99
R7396:Ncor1 UTSW 11 62343218 missense probably damaging 0.99
R7434:Ncor1 UTSW 11 62383199 missense probably damaging 0.99
R7552:Ncor1 UTSW 11 62373424 missense possibly damaging 0.53
R7565:Ncor1 UTSW 11 62401265 missense probably damaging 1.00
R7575:Ncor1 UTSW 11 62383256 missense probably benign 0.21
R7622:Ncor1 UTSW 11 62317968 missense probably benign 0.00
R7664:Ncor1 UTSW 11 62398328 missense probably damaging 1.00
R7814:Ncor1 UTSW 11 62333926 missense probably damaging 0.99
R7963:Ncor1 UTSW 11 62334533 missense probably benign 0.28
R7990:Ncor1 UTSW 11 62349495 critical splice acceptor site probably null
R8302:Ncor1 UTSW 11 62333855 missense probably benign 0.00
R8334:Ncor1 UTSW 11 62383244 missense probably damaging 0.99
R8512:Ncor1 UTSW 11 62433611 small deletion probably benign
R8728:Ncor1 UTSW 11 62330859 missense probably benign 0.04
R8777:Ncor1 UTSW 11 62433666 missense probably benign 0.03
R8777:Ncor1 UTSW 11 62433668 missense probably damaging 1.00
R8777-TAIL:Ncor1 UTSW 11 62433666 missense probably benign 0.03
R8777-TAIL:Ncor1 UTSW 11 62433668 missense probably damaging 1.00
R8821:Ncor1 UTSW 11 62369408 missense probably benign 0.07
R8831:Ncor1 UTSW 11 62369408 missense probably benign 0.07
R8988:Ncor1 UTSW 11 62343045 nonsense probably null
R9111:Ncor1 UTSW 11 62389759 missense possibly damaging 0.95
R9147:Ncor1 UTSW 11 62333846 missense probably damaging 1.00
R9391:Ncor1 UTSW 11 62325550 nonsense probably null
X0065:Ncor1 UTSW 11 62354569 critical splice donor site probably null
X0065:Ncor1 UTSW 11 62358991 missense probably benign 0.23
Z1176:Ncor1 UTSW 11 62438516 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTGGACTGACGTGTACAGTAG -3'
(R):5'- GTGTCCTATGTTTCAAGGCTCC -3'

Sequencing Primer
(F):5'- GGACTGACGTGTACAGTAGTTATAC -3'
(R):5'- ATGTTTCAAGGCTCCCACTTG -3'
Posted On 2016-07-06