Incidental Mutation 'R5271:Syngr1'
ID 400355
Institutional Source Beutler Lab
Gene Symbol Syngr1
Ensembl Gene ENSMUSG00000022415
Gene Name synaptogyrin 1
Synonyms p29, Syngr1b
MMRRC Submission 042861-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock # R5271 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 80091334-80119501 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 80098039 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 9 (M9K)
Ref Sequence ENSEMBL: ENSMUSP00000120696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009727] [ENSMUST00000009728] [ENSMUST00000143928]
AlphaFold O55100
Predicted Effect probably benign
Transcript: ENSMUST00000009727
SMART Domains Protein: ENSMUSP00000009727
Gene: ENSMUSG00000022415

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:MARVEL 20 167 6e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000009728
SMART Domains Protein: ENSMUSP00000009728
Gene: ENSMUSG00000022415

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:MARVEL 20 167 1.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143928
AA Change: M9K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000120696
Gene: ENSMUSG00000022415
AA Change: M9K

DomainStartEndE-ValueType
Pfam:MARVEL 4 111 1.2e-24 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein associated with presynaptic vesicles in neuronal cells. The exact function of this protein is unclear, but studies of a similar murine protein suggest that it functions in synaptic plasticity without being required for synaptic transmission. The gene product belongs to the synaptogyrin gene family. Three alternatively spliced variants encoding three different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a moderate decrease in post-tetanic potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T C 3: 124,579,847 K33R possibly damaging Het
4632415L05Rik C T 3: 19,895,147 noncoding transcript Het
4930542C16Rik A C 14: 24,615,530 noncoding transcript Het
Adprh A T 16: 38,446,054 L242* probably null Het
Anapc1 G A 2: 128,685,985 Q18* probably null Het
Bfar T C 16: 13,692,397 probably benign Het
Bmp1 T C 14: 70,508,128 I206V probably benign Het
Cc2d1b T A 4: 108,623,629 probably benign Het
Clock A G 5: 76,241,954 I349T probably damaging Het
Cox11 A G 11: 90,643,732 Y60C probably damaging Het
Cyp1a1 G A 9: 57,702,838 V512M probably benign Het
Dcdc2a T C 13: 25,187,688 F311S probably benign Het
Dnase1l3 T C 14: 7,993,843 D48G probably damaging Het
Engase G T 11: 118,481,397 A172S probably damaging Het
F2 T C 2: 91,635,121 probably benign Het
Gcc2 T C 10: 58,269,695 V215A possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm14548 A T 7: 3,897,567 Y61* probably null Het
Gm20388 A G 8: 122,271,133 probably benign Het
Gm20671 T C 5: 32,819,959 K1817R possibly damaging Het
Gm20939 T A 17: 94,877,155 Y410* probably null Het
Gm27013 T C 6: 130,676,915 Y528C probably damaging Het
Gm9992 T C 17: 7,369,682 N149S possibly damaging Het
Il23r T C 6: 67,423,696 H550R probably benign Het
Iqgap1 A T 7: 80,734,148 V1056E probably damaging Het
Lrit3 T A 3: 129,788,301 Y679F probably damaging Het
Megf8 A T 7: 25,341,706 E1120V probably damaging Het
Mta1 A G 12: 113,131,957 E518G probably damaging Het
Myo9a A G 9: 59,907,382 I2200M probably damaging Het
Ncoa7 T C 10: 30,722,729 H66R probably benign Het
Ncor1 A G 11: 62,340,545 V812A probably damaging Het
Ndnf T C 6: 65,703,666 Y310H possibly damaging Het
Ndst1 G A 18: 60,705,132 T347I probably benign Het
Olfr1229 A T 2: 89,282,953 F60Y probably benign Het
Olfr512 T C 7: 108,714,217 L276S probably damaging Het
Pcdhb10 C A 18: 37,413,169 Q433K probably benign Het
Pcdhb18 G A 18: 37,491,596 V660M possibly damaging Het
Pds5b T A 5: 150,723,353 N202K possibly damaging Het
Polk T C 13: 96,483,539 S718G probably benign Het
Ptpdc1 T C 13: 48,590,698 D149G probably damaging Het
Rb1cc1 T A 1: 6,249,193 C35* probably null Het
Samd9l C T 6: 3,376,156 M368I probably benign Het
Shroom3 T C 5: 92,962,248 M1739T probably damaging Het
Slc18a3 A G 14: 32,463,748 L226P probably damaging Het
St7l A T 3: 104,868,060 Y84F probably damaging Het
Svil A T 18: 5,062,329 N392I probably benign Het
Taar2 T C 10: 23,941,032 S157P probably damaging Het
Tagap1 G T 17: 6,956,096 Y400* probably null Het
Tbc1d8 T A 1: 39,373,767 E976V probably damaging Het
Tmem163 G A 1: 127,491,552 probably benign Het
Tnfaip2 A G 12: 111,448,460 probably benign Het
Ttn C T 2: 76,706,517 S34988N possibly damaging Het
Tubg1 T G 11: 101,120,238 N15K probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zap70 T A 1: 36,781,365 V547D probably damaging Het
Zfp146 G T 7: 30,162,475 N47K probably benign Het
Znrf1 T G 8: 111,609,344 M159R probably benign Het
Other mutations in Syngr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2092:Syngr1 UTSW 15 80115940 missense possibly damaging 0.93
R2508:Syngr1 UTSW 15 80111740 missense probably damaging 1.00
R3887:Syngr1 UTSW 15 80116039 missense probably damaging 0.99
R5091:Syngr1 UTSW 15 80115885 missense probably damaging 1.00
R5255:Syngr1 UTSW 15 80091446 missense possibly damaging 0.78
R5440:Syngr1 UTSW 15 80098018 missense probably benign
R6369:Syngr1 UTSW 15 80115590 unclassified probably benign
R6596:Syngr1 UTSW 15 80111692 missense probably damaging 0.98
R7216:Syngr1 UTSW 15 80111733 missense probably damaging 1.00
R7834:Syngr1 UTSW 15 80111617 missense probably damaging 1.00
R8395:Syngr1 UTSW 15 80113244 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAGGACCTCTGCATGCATG -3'
(R):5'- TTCACAGGGGAGGTGACAGTTC -3'

Sequencing Primer
(F):5'- GCATGCCCTTACAGTAAATTCAGAGG -3'
(R):5'- GGCAGAGTAGAAGTCCCACATC -3'
Posted On 2016-07-06