Incidental Mutation 'R0456:Nxn'
ID40036
Institutional Source Beutler Lab
Gene Symbol Nxn
Ensembl Gene ENSMUSG00000020844
Gene Namenucleoredoxin
Synonymsl11Jus13
MMRRC Submission 038656-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0456 (G1)
Quality Score197
Status Not validated
Chromosome11
Chromosomal Location76257198-76399140 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 76263137 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 291 (Q291*)
Ref Sequence ENSEMBL: ENSMUSP00000021204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021204]
Predicted Effect probably null
Transcript: ENSMUST00000021204
AA Change: Q291*
SMART Domains Protein: ENSMUSP00000021204
Gene: ENSMUSG00000020844
AA Change: Q291*

DomainStartEndE-ValueType
Pfam:Thioredoxin_8 30 145 5.4e-23 PFAM
Pfam:AhpC-TSA 173 290 4.7e-10 PFAM
Pfam:Thioredoxin_2 189 296 7.1e-11 PFAM
Pfam:Thioredoxin_8 193 287 3.7e-32 PFAM
Pfam:Thioredoxin_6 236 424 8.4e-9 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the thioredoxin superfamily, a group of small, multifunctional redox-active proteins. Members of this family are characterized by a conserved active motif called the thioredoxin fold that catalyzes disulfide bond formation and isomerization. The encoded protein acts a redox-dependent regulator of the Wnt signaling pathway and is involved in cell growth and differentiation. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice die by P1 and exhibit craniofacial bone defects and cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 G A 18: 12,295,979 P11L probably damaging Het
Antxr1 A C 6: 87,217,275 V347G probably damaging Het
Atp13a5 T C 16: 29,232,740 N1127D probably benign Het
Bivm T A 1: 44,126,809 W140R probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Ceacam5 T C 7: 17,760,851 V928A possibly damaging Het
Chia1 T C 3: 106,128,479 Y152H probably damaging Het
Chsy3 A T 18: 59,176,478 I268F probably damaging Het
CK137956 A T 4: 127,945,307 N439K probably damaging Het
Csf3r C A 4: 126,035,861 N392K probably damaging Het
Cyp1b1 T C 17: 79,710,275 I484V probably benign Het
Dsc1 T C 18: 20,099,112 K280E probably damaging Het
Eefsec A G 6: 88,297,888 Y365H probably benign Het
Epb41l4b C T 4: 57,142,843 probably null Het
Erap1 G A 13: 74,664,220 V385I probably benign Het
Fat1 A T 8: 45,029,534 I3077F probably damaging Het
Fras1 G T 5: 96,554,788 G230C probably damaging Het
Fras1 T G 5: 96,714,343 probably null Het
Gsg1l A G 7: 125,923,510 M182T possibly damaging Het
Gzmg A G 14: 56,158,322 V60A probably damaging Het
Hapln4 A T 8: 70,084,995 Y113F probably benign Het
Hist1h4f T C 13: 23,551,387 D86G probably damaging Het
Ikzf4 T A 10: 128,635,808 T274S probably damaging Het
Kansl1l T A 1: 66,735,726 H302L probably damaging Het
Klhl41 T C 2: 69,670,549 V118A probably damaging Het
Kpna1 T C 16: 36,002,900 S41P possibly damaging Het
Krt23 A G 11: 99,486,778 V134A probably benign Het
Lamb1 G A 12: 31,304,730 C992Y probably damaging Het
Lrif1 C T 3: 106,731,778 P35S probably benign Het
Lrrc4 A G 6: 28,831,104 S171P probably damaging Het
Lvrn G A 18: 46,864,816 probably null Het
Matr3 T A 18: 35,572,864 F281I probably damaging Het
Olfr1467 A G 19: 13,364,738 T37A probably damaging Het
Pdp2 G T 8: 104,593,789 R90L probably damaging Het
Ppp1r3c C A 19: 36,733,891 E160* probably null Het
Ppp2r5c T G 12: 110,522,579 S118R probably damaging Het
Ptpn23 G T 9: 110,389,793 probably null Het
Ptpro G T 6: 137,414,230 V783L probably benign Het
Rab40c A G 17: 25,884,657 V144A possibly damaging Het
Rasal2 T C 1: 157,149,843 N1087S probably damaging Het
Rfc3 T A 5: 151,647,523 S103C possibly damaging Het
Rgl2 A G 17: 33,936,849 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rit2 A T 18: 30,975,451 F160L probably benign Het
Rnh1 A G 7: 141,162,548 S366P possibly damaging Het
Sdk2 T C 11: 113,791,466 Y2029C possibly damaging Het
Smpd3 T A 8: 106,259,656 I505F probably benign Het
Sorcs3 A T 19: 48,654,044 S379C possibly damaging Het
Sult1e1 A G 5: 87,578,634 L207P possibly damaging Het
Sycp2 C G 2: 178,381,855 S456T probably benign Het
Syne1 T C 10: 5,342,252 T1339A probably benign Het
Tas2r117 A G 6: 132,803,391 N164S probably benign Het
Tigd3 A G 19: 5,892,793 L103P probably damaging Het
Tldc1 A T 8: 119,768,423 F199I probably damaging Het
Tmem132b T C 5: 125,787,724 S965P probably damaging Het
Tmem82 T C 4: 141,617,390 T81A probably benign Het
Tmem8b A G 4: 43,685,618 T156A probably benign Het
Tnfrsf21 A G 17: 43,038,091 E198G probably benign Het
Tnpo2 A G 8: 85,054,416 N767S probably damaging Het
Trf T C 9: 103,226,903 Y87C probably damaging Het
Tst A G 15: 78,405,580 V85A probably damaging Het
Usp37 A T 1: 74,468,348 N503K probably damaging Het
Utp20 C T 10: 88,754,573 M2346I possibly damaging Het
Vax2 A G 6: 83,711,406 D37G probably benign Het
Vmn1r77 T A 7: 12,041,738 L79* probably null Het
Zbtb3 A T 19: 8,803,200 D59V probably damaging Het
Zdhhc13 T C 7: 48,808,854 F182S probably benign Het
Zfp426 A G 9: 20,470,297 F465L probably damaging Het
Zfp526 A G 7: 25,226,212 E632G probably damaging Het
Other mutations in Nxn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Nxn APN 11 76274655 splice site probably benign
IGL01780:Nxn APN 11 76274654 splice site probably benign
IGL02350:Nxn APN 11 76274654 splice site probably benign
IGL02357:Nxn APN 11 76274654 splice site probably benign
IGL02423:Nxn APN 11 76274032 missense probably benign 0.13
R0098:Nxn UTSW 11 76278594 splice site probably benign
R1127:Nxn UTSW 11 76274069 nonsense probably null
R1473:Nxn UTSW 11 76263187 missense possibly damaging 0.93
R1681:Nxn UTSW 11 76272464 missense probably benign 0.03
R1917:Nxn UTSW 11 76261672 splice site probably benign
R1918:Nxn UTSW 11 76261672 splice site probably benign
R2010:Nxn UTSW 11 76398801 missense probably damaging 0.99
R4501:Nxn UTSW 11 76274612 missense probably damaging 0.98
R4827:Nxn UTSW 11 76261592 missense probably benign 0.01
R5029:Nxn UTSW 11 76274530 nonsense probably null
R5078:Nxn UTSW 11 76261607 missense probably damaging 1.00
R6403:Nxn UTSW 11 76399020 missense probably benign 0.22
R7088:Nxn UTSW 11 76263148 missense possibly damaging 0.94
R7478:Nxn UTSW 11 76261552 missense probably damaging 0.97
R7642:Nxn UTSW 11 76272459 missense probably damaging 1.00
R7830:Nxn UTSW 11 76273993 missense probably damaging 1.00
X0062:Nxn UTSW 11 76263152 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CATGAGAGGTCCATTCTGACCTGC -3'
(R):5'- TTTCCTTGGAGCGACTCCACACAG -3'

Sequencing Primer
(F):5'- ATTCTGACCTGCCTTCCAC -3'
(R):5'- CAGCAACTGGGCTTACTTTTAG -3'
Posted On2013-05-23