Incidental Mutation 'R5271:Pcdhb10'
ID 400369
Institutional Source Beutler Lab
Gene Symbol Pcdhb10
Ensembl Gene ENSMUSG00000045657
Gene Name protocadherin beta 10
Synonyms Pcdhb5D, PcdhbJ
MMRRC Submission 042861-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock # R5271 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 37411664-37414514 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 37413169 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 433 (Q433K)
Ref Sequence ENSEMBL: ENSMUSP00000056420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051126] [ENSMUST00000115661] [ENSMUST00000194544]
AlphaFold Q91VE5
Predicted Effect probably benign
Transcript: ENSMUST00000051126
AA Change: Q433K

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000056420
Gene: ENSMUSG00000045657
AA Change: Q433K

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 5.5e-33 PFAM
CA 155 240 5.59e-23 SMART
CA 264 344 5.17e-27 SMART
CA 367 448 5.59e-23 SMART
CA 472 558 6.62e-25 SMART
CA 588 669 2.03e-11 SMART
Pfam:Cadherin_C_2 686 769 1.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T C 3: 124,579,847 K33R possibly damaging Het
4632415L05Rik C T 3: 19,895,147 noncoding transcript Het
4930542C16Rik A C 14: 24,615,530 noncoding transcript Het
Adprh A T 16: 38,446,054 L242* probably null Het
Anapc1 G A 2: 128,685,985 Q18* probably null Het
Bfar T C 16: 13,692,397 probably benign Het
Bmp1 T C 14: 70,508,128 I206V probably benign Het
Cc2d1b T A 4: 108,623,629 probably benign Het
Clock A G 5: 76,241,954 I349T probably damaging Het
Cox11 A G 11: 90,643,732 Y60C probably damaging Het
Cyp1a1 G A 9: 57,702,838 V512M probably benign Het
Dcdc2a T C 13: 25,187,688 F311S probably benign Het
Dnase1l3 T C 14: 7,993,843 D48G probably damaging Het
Engase G T 11: 118,481,397 A172S probably damaging Het
F2 T C 2: 91,635,121 probably benign Het
Gcc2 T C 10: 58,269,695 V215A possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm14548 A T 7: 3,897,567 Y61* probably null Het
Gm20388 A G 8: 122,271,133 probably benign Het
Gm20671 T C 5: 32,819,959 K1817R possibly damaging Het
Gm20939 T A 17: 94,877,155 Y410* probably null Het
Gm27013 T C 6: 130,676,915 Y528C probably damaging Het
Gm9992 T C 17: 7,369,682 N149S possibly damaging Het
Il23r T C 6: 67,423,696 H550R probably benign Het
Iqgap1 A T 7: 80,734,148 V1056E probably damaging Het
Lrit3 T A 3: 129,788,301 Y679F probably damaging Het
Megf8 A T 7: 25,341,706 E1120V probably damaging Het
Mta1 A G 12: 113,131,957 E518G probably damaging Het
Myo9a A G 9: 59,907,382 I2200M probably damaging Het
Ncoa7 T C 10: 30,722,729 H66R probably benign Het
Ncor1 A G 11: 62,340,545 V812A probably damaging Het
Ndnf T C 6: 65,703,666 Y310H possibly damaging Het
Ndst1 G A 18: 60,705,132 T347I probably benign Het
Olfr1229 A T 2: 89,282,953 F60Y probably benign Het
Olfr512 T C 7: 108,714,217 L276S probably damaging Het
Pcdhb18 G A 18: 37,491,596 V660M possibly damaging Het
Pds5b T A 5: 150,723,353 N202K possibly damaging Het
Polk T C 13: 96,483,539 S718G probably benign Het
Ptpdc1 T C 13: 48,590,698 D149G probably damaging Het
Rb1cc1 T A 1: 6,249,193 C35* probably null Het
Samd9l C T 6: 3,376,156 M368I probably benign Het
Shroom3 T C 5: 92,962,248 M1739T probably damaging Het
Slc18a3 A G 14: 32,463,748 L226P probably damaging Het
St7l A T 3: 104,868,060 Y84F probably damaging Het
Svil A T 18: 5,062,329 N392I probably benign Het
Syngr1 T A 15: 80,098,039 M9K probably benign Het
Taar2 T C 10: 23,941,032 S157P probably damaging Het
Tagap1 G T 17: 6,956,096 Y400* probably null Het
Tbc1d8 T A 1: 39,373,767 E976V probably damaging Het
Tmem163 G A 1: 127,491,552 probably benign Het
Tnfaip2 A G 12: 111,448,460 probably benign Het
Ttn C T 2: 76,706,517 S34988N possibly damaging Het
Tubg1 T G 11: 101,120,238 N15K probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zap70 T A 1: 36,781,365 V547D probably damaging Het
Zfp146 G T 7: 30,162,475 N47K probably benign Het
Znrf1 T G 8: 111,609,344 M159R probably benign Het
Other mutations in Pcdhb10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Pcdhb10 APN 18 37412195 missense probably damaging 0.96
IGL01383:Pcdhb10 APN 18 37413275 missense probably benign 0.14
IGL01765:Pcdhb10 APN 18 37414019 missense probably benign 0.00
IGL02240:Pcdhb10 APN 18 37412402 missense possibly damaging 0.90
IGL02548:Pcdhb10 APN 18 37412690 missense probably benign 0.00
IGL02563:Pcdhb10 APN 18 37413073 missense probably benign 0.26
IGL02598:Pcdhb10 APN 18 37413781 missense possibly damaging 0.89
IGL02711:Pcdhb10 APN 18 37412726 missense possibly damaging 0.56
IGL02813:Pcdhb10 APN 18 37413762 missense possibly damaging 0.94
IGL02893:Pcdhb10 APN 18 37413634 missense probably damaging 1.00
IGL03288:Pcdhb10 APN 18 37413305 missense probably damaging 1.00
IGL03310:Pcdhb10 APN 18 37412321 missense probably damaging 0.97
R0004:Pcdhb10 UTSW 18 37411959 missense probably benign
R0004:Pcdhb10 UTSW 18 37411959 missense probably benign
R0211:Pcdhb10 UTSW 18 37414006 missense probably benign
R0211:Pcdhb10 UTSW 18 37414006 missense probably benign
R0389:Pcdhb10 UTSW 18 37412432 missense probably damaging 1.00
R0443:Pcdhb10 UTSW 18 37412432 missense probably damaging 1.00
R0480:Pcdhb10 UTSW 18 37413099 missense probably damaging 1.00
R1218:Pcdhb10 UTSW 18 37413161 missense probably damaging 1.00
R1448:Pcdhb10 UTSW 18 37412503 missense possibly damaging 0.89
R1737:Pcdhb10 UTSW 18 37412956 missense probably benign 0.01
R2092:Pcdhb10 UTSW 18 37414187 missense probably benign 0.00
R2277:Pcdhb10 UTSW 18 37412624 missense possibly damaging 0.82
R2363:Pcdhb10 UTSW 18 37414137 nonsense probably null
R3826:Pcdhb10 UTSW 18 37412417 missense probably damaging 1.00
R4372:Pcdhb10 UTSW 18 37413313 missense possibly damaging 0.95
R4412:Pcdhb10 UTSW 18 37414141 frame shift probably null
R4760:Pcdhb10 UTSW 18 37411942 missense probably benign 0.05
R4941:Pcdhb10 UTSW 18 37412834 missense probably benign 0.29
R5643:Pcdhb10 UTSW 18 37413166 missense possibly damaging 0.63
R5851:Pcdhb10 UTSW 18 37412758 missense probably benign 0.00
R6089:Pcdhb10 UTSW 18 37413626 missense possibly damaging 0.91
R6125:Pcdhb10 UTSW 18 37413626 missense possibly damaging 0.91
R6189:Pcdhb10 UTSW 18 37412403 missense probably damaging 0.99
R6414:Pcdhb10 UTSW 18 37413845 missense possibly damaging 0.95
R6731:Pcdhb10 UTSW 18 37413476 missense probably benign 0.02
R6999:Pcdhb10 UTSW 18 37413118 missense probably damaging 1.00
R7019:Pcdhb10 UTSW 18 37413003 missense probably damaging 1.00
R7317:Pcdhb10 UTSW 18 37413026 missense possibly damaging 0.67
R7554:Pcdhb10 UTSW 18 37411882 missense probably benign
R7638:Pcdhb10 UTSW 18 37412312 missense probably benign 0.03
R7710:Pcdhb10 UTSW 18 37413601 nonsense probably null
R7763:Pcdhb10 UTSW 18 37411882 missense not run
R7867:Pcdhb10 UTSW 18 37413566 missense probably benign 0.03
R8269:Pcdhb10 UTSW 18 37414009 missense probably benign 0.09
R8355:Pcdhb10 UTSW 18 37412081 missense probably damaging 1.00
R9265:Pcdhb10 UTSW 18 37413500 missense possibly damaging 0.82
X0024:Pcdhb10 UTSW 18 37412998 missense probably benign 0.12
X0036:Pcdhb10 UTSW 18 37411973 missense probably damaging 1.00
Z1176:Pcdhb10 UTSW 18 37413395 frame shift probably null
Z1177:Pcdhb10 UTSW 18 37412543 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGCTCCTGAGACTGTAGTGG -3'
(R):5'- GCAGCAGCGAGTATGTGATG -3'

Sequencing Primer
(F):5'- CTGATCCGGATTCTGGGGAAAATG -3'
(R):5'- CAGCGAGTATGTGATGTGGGC -3'
Posted On 2016-07-06