Mutagenetix > Incidental Mutations

Incidental Mutation 'R5272:Dis3l2'

400375

Institutional Source

Beutler Lab

Gene Symbol

Dis3l2

Ensembl Gene

ENSMUSG00000053333

Gene Name

DIS3 like 3'-5' exoribonuclease 2

Synonyms

4930429A22Rik, 8030493P09Rik

MMRRC Submission

042836-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.342) question?

Stock #

R5272 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86703808-87050095 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86973404 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 439 (V439A)

Ref Sequence

ENSEMBL: ENSMUSP00000070506 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065694] [ENSMUST00000168237] [ENSMUST00000190618]

AlphaFold

Q8CI75

PDB Structure

Structure of mouse Dis3L2 in complex with oligoU RNA substrate [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065694
AA Change: V439A

PolyPhen 2 Score 0.717 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000070506
Gene: ENSMUSG00000053333
AA Change: V439A

Domain	Start	End	E-Value	Type
low complexity region	12	33	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
RNB	369	719	8.9e-140	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168237
AA Change: V453A

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000132673
Gene: ENSMUSG00000053333
AA Change: V453A

Domain	Start	End	E-Value	Type
low complexity region	12	33	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
RNB	383	733	8.9e-140	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185304

Predicted Effect

probably benign
Transcript: ENSMUST00000190618

SMART Domains

Protein: ENSMUSP00000139579
Gene: ENSMUSG00000053333

Domain	Start	End	E-Value	Type
low complexity region	12	33	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
PDB:2VNU\|D	50	123	4e-10	PDB

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar in sequence to 3'/5' exonucleolytic subunits of the RNA exosome. The exosome is a large multimeric ribonucleotide complex responsible for degrading various RNA substrates. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Mar 2012]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl6a	A	G	3: 32,718,610	E245G	probably damaging	Het
Arsb	A	T	13: 93,794,162	T213S	possibly damaging	Het
C77080	T	C	4: 129,224,212	T208A	possibly damaging	Het
Cep152	G	A	2: 125,611,030	T374I	probably benign	Het
Crx	C	T	7: 15,868,285	C156Y	probably damaging	Het
Csmd1	T	A	8: 16,199,944	T1007S	probably damaging	Het
Cyp19a1	A	T	9: 54,176,614	C164S	probably benign	Het
Ddx55	A	T	5: 124,558,029	I137F	possibly damaging	Het
Dgkg	C	A	16: 22,588,294		probably null	Het
Dicer1	A	G	12: 104,704,240	I1022T	probably damaging	Het
Dnah5	T	C	15: 28,350,665	V2611A	probably benign	Het
Dnah6	A	G	6: 73,127,861		probably null	Het
Ercc6	A	T	14: 32,519,028	K170*	probably null	Het
Fibcd1	A	T	2: 31,816,623	C399S	probably damaging	Het
Fibcd1	G	T	2: 31,816,624	N398K	probably damaging	Het
Fnbp4	G	A	2: 90,753,115	M327I	probably benign	Het
Fryl	A	T	5: 73,065,136	L256*	probably null	Het
Galr1	T	A	18: 82,405,636	Y172F	probably benign	Het
Gpi1	T	C	7: 34,220,690	N186S	probably damaging	Het
Kcnh8	A	G	17: 52,905,015	I614V	probably damaging	Het
Krt23	A	T	11: 99,478,273	I398N	probably damaging	Het
Mia3	G	A	1: 183,328,270	R656*	probably null	Het
Mup6	G	C	4: 60,005,922	G138A	probably damaging	Het
Nectin3	A	G	16: 46,448,476	V521A	possibly damaging	Het
Nphs1	A	G	7: 30,481,642	E1096G	possibly damaging	Het
Olfr284	G	A	15: 98,340,365	A208V	probably benign	Het
Panx1	C	T	9: 15,044,856		probably null	Het
Pcdhb4	A	G	18: 37,307,766	Y43C	probably benign	Het
Plbd1	A	G	6: 136,640,158	Y62H	probably damaging	Het
Rab40b	A	G	11: 121,357,308	V190A	probably damaging	Het
Ryr3	T	C	2: 112,653,213	E4063G	probably damaging	Het
Smlr1	T	C	10: 25,536,027	I21V	probably benign	Het
Tenm4	T	A	7: 96,874,203	Y1614N	probably damaging	Het
Tesmin	C	A	19: 3,406,992	A257E	probably damaging	Het
Tgif1	A	G	17: 70,846,254	L34P	probably damaging	Het
Ticrr	C	A	7: 79,669,605	T446K	probably benign	Het
Tmc7	A	G	7: 118,561,053	I187T	probably benign	Het
Tpst2	T	A	5: 112,307,952	V119E	probably damaging	Het
Trf	A	T	9: 103,227,978	M45K	probably damaging	Het
Trim45	T	C	3: 100,929,919	C524R	probably damaging	Het
Ttc27	G	A	17: 74,742,977	V293I	probably damaging	Het
Ugt1a6b	C	T	1: 88,107,227	R96C	possibly damaging	Het
Vit	A	G	17: 78,586,835	Q222R	probably benign	Het
Zfp148	T	A	16: 33,496,224	V380D	probably damaging	Het

Other mutations in Dis3l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01382:Dis3l2	APN	1	86857203	missense	probably benign	0.00
IGL01607:Dis3l2	APN	1	86745487	missense	probably benign	0.04
IGL02233:Dis3l2	APN	1	86990231	missense	probably damaging	1.00
IGL02698:Dis3l2	APN	1	87048829	splice site	probably benign
R0514:Dis3l2	UTSW	1	87047092	missense	probably damaging	1.00
R0893:Dis3l2	UTSW	1	87044206	splice site	probably null
R1086:Dis3l2	UTSW	1	86990149	missense	probably benign	0.36
R1140:Dis3l2	UTSW	1	86821438	missense	probably benign	0.00
R1509:Dis3l2	UTSW	1	87021086	missense	possibly damaging	0.91
R2029:Dis3l2	UTSW	1	86854467	splice site	probably benign
R2511:Dis3l2	UTSW	1	86990258	missense	probably benign	0.05
R3772:Dis3l2	UTSW	1	86854408	missense	probably benign
R4163:Dis3l2	UTSW	1	86821237	missense	probably benign	0.00
R4547:Dis3l2	UTSW	1	87049671	missense	probably benign	0.00
R4548:Dis3l2	UTSW	1	87049671	missense	probably benign	0.00
R4650:Dis3l2	UTSW	1	86990321	missense	possibly damaging	0.83
R4810:Dis3l2	UTSW	1	87047574	missense	probably damaging	0.99
R4936:Dis3l2	UTSW	1	87044168	missense	probably benign	0.00
R5010:Dis3l2	UTSW	1	86760321	missense	probably benign	0.21
R5040:Dis3l2	UTSW	1	86857337	missense	probably damaging	0.98
R5500:Dis3l2	UTSW	1	87021119	critical splice donor site	probably null
R5556:Dis3l2	UTSW	1	86973404	missense	possibly damaging	0.72
R5772:Dis3l2	UTSW	1	86878432	missense	probably damaging	1.00
R5808:Dis3l2	UTSW	1	87049638	missense	possibly damaging	0.94
R5950:Dis3l2	UTSW	1	87021108	missense	probably damaging	0.96
R6328:Dis3l2	UTSW	1	86854431	missense	probably benign	0.05
R6553:Dis3l2	UTSW	1	86745494	missense	probably damaging	1.00
R6585:Dis3l2	UTSW	1	86745494	missense	probably damaging	1.00
R6905:Dis3l2	UTSW	1	87044839	missense	probably benign	0.00
R6921:Dis3l2	UTSW	1	86857341	missense	probably benign
R7162:Dis3l2	UTSW	1	87044030	missense	possibly damaging	0.94
R7270:Dis3l2	UTSW	1	86990303	missense	possibly damaging	0.49
R7438:Dis3l2	UTSW	1	86745500	critical splice donor site	probably null
R8422:Dis3l2	UTSW	1	86854377	missense	probably benign
R8696:Dis3l2	UTSW	1	86791440	nonsense	probably null
R9235:Dis3l2	UTSW	1	86821339	missense	possibly damaging	0.95
R9291:Dis3l2	UTSW	1	86973493	missense	possibly damaging	0.82
X0027:Dis3l2	UTSW	1	86760351	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- ACAAACAGTGACAGTGTTTCTG -3'
(R):5'- CACGGTGCTTACCACAAGAG -3'

Sequencing Primer
(F):5'- TACTTCCCAGGCAGAGCTGAG -3'
(R):5'- CGGTGCTTACCACAAGAGATAGG -3'

Posted On

2016-07-06