Incidental Mutation 'R5272:Ugt1a6b'
ID400377
Institutional Source Beutler Lab
Gene Symbol Ugt1a6b
Ensembl Gene ENSMUSG00000090145
Gene NameUDP glucuronosyltransferase 1 family, polypeptide A6B
SynonymsA9'
MMRRC Submission 042836-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R5272 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location88103252-88219003 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88107227 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 96 (R96C)
Ref Sequence ENSEMBL: ENSMUSP00000108763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058237] [ENSMUST00000073772] [ENSMUST00000113135] [ENSMUST00000113137] [ENSMUST00000113138] [ENSMUST00000113139] [ENSMUST00000113142] [ENSMUST00000126203] [ENSMUST00000138182] [ENSMUST00000150634] [ENSMUST00000173325]
Predicted Effect probably benign
Transcript: ENSMUST00000058237
SMART Domains Protein: ENSMUSP00000058683
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 522 1.5e-234 PFAM
Pfam:Glyco_tran_28_C 361 450 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073772
SMART Domains Protein: ENSMUSP00000073444
Gene: ENSMUSG00000090175

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 519 2.3e-232 PFAM
Pfam:Glyco_tran_28_C 358 447 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113135
SMART Domains Protein: ENSMUSP00000108760
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.2e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 1e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113137
AA Change: R96C

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108762
Gene: ENSMUSG00000090145
AA Change: R96C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.3e-231 PFAM
Pfam:Glyco_tran_28_C 361 450 2.8e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113138
AA Change: R96C

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108763
Gene: ENSMUSG00000090145
AA Change: R96C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 7.3e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 6.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113139
SMART Domains Protein: ENSMUSP00000108764
Gene: ENSMUSG00000089675

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 3.6e-237 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113142
SMART Domains Protein: ENSMUSP00000108767
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 7.3e-231 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126203
SMART Domains Protein: ENSMUSP00000116653
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 4.6e-11 PFAM
Pfam:UDPGT 59 127 8.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138182
SMART Domains Protein: ENSMUSP00000119985
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 7e-11 PFAM
Pfam:UDPGT 58 207 1.9e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150634
SMART Domains Protein: ENSMUSP00000123452
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 9.5e-11 PFAM
Pfam:UDPGT 58 207 2e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173165
Predicted Effect probably benign
Transcript: ENSMUST00000173325
SMART Domains Protein: ENSMUSP00000134443
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 61 3.4e-10 PFAM
Pfam:UDPGT 59 210 8.9e-92 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A G 3: 32,718,610 E245G probably damaging Het
Arsb A T 13: 93,794,162 T213S possibly damaging Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Cep152 G A 2: 125,611,030 T374I probably benign Het
Crx C T 7: 15,868,285 C156Y probably damaging Het
Csmd1 T A 8: 16,199,944 T1007S probably damaging Het
Cyp19a1 A T 9: 54,176,614 C164S probably benign Het
Ddx55 A T 5: 124,558,029 I137F possibly damaging Het
Dgkg C A 16: 22,588,294 probably null Het
Dicer1 A G 12: 104,704,240 I1022T probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Dnah5 T C 15: 28,350,665 V2611A probably benign Het
Dnah6 A G 6: 73,127,861 probably null Het
Ercc6 A T 14: 32,519,028 K170* probably null Het
Fibcd1 A T 2: 31,816,623 C399S probably damaging Het
Fibcd1 G T 2: 31,816,624 N398K probably damaging Het
Fnbp4 G A 2: 90,753,115 M327I probably benign Het
Fryl A T 5: 73,065,136 L256* probably null Het
Galr1 T A 18: 82,405,636 Y172F probably benign Het
Gpi1 T C 7: 34,220,690 N186S probably damaging Het
Kcnh8 A G 17: 52,905,015 I614V probably damaging Het
Krt23 A T 11: 99,478,273 I398N probably damaging Het
Mia3 G A 1: 183,328,270 R656* probably null Het
Mup6 G C 4: 60,005,922 G138A probably damaging Het
Nectin3 A G 16: 46,448,476 V521A possibly damaging Het
Nphs1 A G 7: 30,481,642 E1096G possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Panx1 C T 9: 15,044,856 probably null Het
Pcdhb4 A G 18: 37,307,766 Y43C probably benign Het
Plbd1 A G 6: 136,640,158 Y62H probably damaging Het
Rab40b A G 11: 121,357,308 V190A probably damaging Het
Ryr3 T C 2: 112,653,213 E4063G probably damaging Het
Smlr1 T C 10: 25,536,027 I21V probably benign Het
Tenm4 T A 7: 96,874,203 Y1614N probably damaging Het
Tesmin C A 19: 3,406,992 A257E probably damaging Het
Tgif1 A G 17: 70,846,254 L34P probably damaging Het
Ticrr C A 7: 79,669,605 T446K probably benign Het
Tmc7 A G 7: 118,561,053 I187T probably benign Het
Tpst2 T A 5: 112,307,952 V119E probably damaging Het
Trf A T 9: 103,227,978 M45K probably damaging Het
Trim45 T C 3: 100,929,919 C524R probably damaging Het
Ttc27 G A 17: 74,742,977 V293I probably damaging Het
Vit A G 17: 78,586,835 Q222R probably benign Het
Zfp148 T A 16: 33,496,224 V380D probably damaging Het
Other mutations in Ugt1a6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Ugt1a6b APN 1 88107605 missense possibly damaging 0.93
IGL00990:Ugt1a6b APN 1 88215178 splice site probably null
IGL02139:Ugt1a6b APN 1 88107805 intron probably benign
PIT4131001:Ugt1a6b UTSW 1 88216158 small deletion probably benign
PIT4131001:Ugt1a6b UTSW 1 88216254 missense probably damaging 1.00
PIT4131001:Ugt1a6b UTSW 1 88218390 missense probably damaging 1.00
R0164:Ugt1a6b UTSW 1 88107467 missense probably damaging 0.99
R0966:Ugt1a6b UTSW 1 88107128 missense probably benign 0.04
R1368:Ugt1a6b UTSW 1 88107636 missense probably benign 0.08
R1542:Ugt1a6b UTSW 1 88107261 missense probably benign 0.04
R3693:Ugt1a6b UTSW 1 88107794 missense probably benign
R4528:Ugt1a6b UTSW 1 88107579 missense probably damaging 0.99
R5206:Ugt1a6b UTSW 1 88107448 nonsense probably null
R5977:Ugt1a6b UTSW 1 88216260 missense probably damaging 1.00
R6640:Ugt1a6b UTSW 1 88107794 missense probably benign
R6723:Ugt1a6b UTSW 1 88107717 missense probably benign 0.15
Z31818:Ugt1a6b UTSW 1 88107155 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCTAGGTGACAAGCTGCTGG -3'
(R):5'- GGCAGGTTGAGATACTCAGC -3'

Sequencing Primer
(F):5'- ACAAGCTGCTGGTGGTC -3'
(R):5'- GGATCACACCACAGGGCATG -3'
Posted On2016-07-06