Incidental Mutation 'R5272:Mia3'
ID400379
Institutional Source Beutler Lab
Gene Symbol Mia3
Ensembl Gene ENSMUSG00000056050
Gene Namemelanoma inhibitory activity 3
Synonyms9130229H14Rik, B230399H06Rik, LOC385255, A930039G15Rik, Tango
MMRRC Submission 042836-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5272 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location183326725-183369553 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 183328270 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 656 (R656*)
Ref Sequence ENSEMBL: ENSMUSP00000104786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109158] [ENSMUST00000109166] [ENSMUST00000193625]
Predicted Effect probably null
Transcript: ENSMUST00000069922
AA Change: R337*
SMART Domains Protein: ENSMUSP00000064801
Gene: ENSMUSG00000056050
AA Change: R337*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SH3 48 106 2.78e-2 SMART
low complexity region 138 147 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
low complexity region 767 774 N/A INTRINSIC
coiled coil region 1240 1329 N/A INTRINSIC
coiled coil region 1362 1427 N/A INTRINSIC
low complexity region 1433 1446 N/A INTRINSIC
coiled coil region 1517 1565 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109158
AA Change: R656*
SMART Domains Protein: ENSMUSP00000104786
Gene: ENSMUSG00000056050
AA Change: R656*

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
SCOP:d1fxkc_ 159 274 2e-4 SMART
low complexity region 281 294 N/A INTRINSIC
SCOP:d1fxkc_ 365 463 1e-3 SMART
low complexity region 482 498 N/A INTRINSIC
low complexity region 557 567 N/A INTRINSIC
low complexity region 609 626 N/A INTRINSIC
low complexity region 635 661 N/A INTRINSIC
low complexity region 665 680 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109166
SMART Domains Protein: ENSMUSP00000104795
Gene: ENSMUSG00000042901

DomainStartEndE-ValueType
Pfam:Aida_N 9 112 1.9e-43 PFAM
low complexity region 122 144 N/A INTRINSIC
Pfam:Aida_C2 155 300 2.4e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193359
Predicted Effect probably benign
Transcript: ENSMUST00000193625
SMART Domains Protein: ENSMUSP00000141649
Gene: ENSMUSG00000042901

DomainStartEndE-ValueType
Pfam:Aida_N 8 113 2.3e-49 PFAM
low complexity region 122 144 N/A INTRINSIC
Pfam:Aida_C2 145 219 6.4e-36 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous null for the large isoform display complete perinatal lethality with impaired collagen secretion, intracellular collagen aggregates, short limbed dwarfism, and arrest of chondrocyte maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A G 3: 32,718,610 E245G probably damaging Het
Arsb A T 13: 93,794,162 T213S possibly damaging Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Cep152 G A 2: 125,611,030 T374I probably benign Het
Crx C T 7: 15,868,285 C156Y probably damaging Het
Csmd1 T A 8: 16,199,944 T1007S probably damaging Het
Cyp19a1 A T 9: 54,176,614 C164S probably benign Het
Ddx55 A T 5: 124,558,029 I137F possibly damaging Het
Dgkg C A 16: 22,588,294 probably null Het
Dicer1 A G 12: 104,704,240 I1022T probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Dnah5 T C 15: 28,350,665 V2611A probably benign Het
Dnah6 A G 6: 73,127,861 probably null Het
Ercc6 A T 14: 32,519,028 K170* probably null Het
Fibcd1 A T 2: 31,816,623 C399S probably damaging Het
Fibcd1 G T 2: 31,816,624 N398K probably damaging Het
Fnbp4 G A 2: 90,753,115 M327I probably benign Het
Fryl A T 5: 73,065,136 L256* probably null Het
Galr1 T A 18: 82,405,636 Y172F probably benign Het
Gpi1 T C 7: 34,220,690 N186S probably damaging Het
Kcnh8 A G 17: 52,905,015 I614V probably damaging Het
Krt23 A T 11: 99,478,273 I398N probably damaging Het
Mup6 G C 4: 60,005,922 G138A probably damaging Het
Nectin3 A G 16: 46,448,476 V521A possibly damaging Het
Nphs1 A G 7: 30,481,642 E1096G possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Panx1 C T 9: 15,044,856 probably null Het
Pcdhb4 A G 18: 37,307,766 Y43C probably benign Het
Plbd1 A G 6: 136,640,158 Y62H probably damaging Het
Rab40b A G 11: 121,357,308 V190A probably damaging Het
Ryr3 T C 2: 112,653,213 E4063G probably damaging Het
Smlr1 T C 10: 25,536,027 I21V probably benign Het
Tenm4 T A 7: 96,874,203 Y1614N probably damaging Het
Tesmin C A 19: 3,406,992 A257E probably damaging Het
Tgif1 A G 17: 70,846,254 L34P probably damaging Het
Ticrr C A 7: 79,669,605 T446K probably benign Het
Tmc7 A G 7: 118,561,053 I187T probably benign Het
Tpst2 T A 5: 112,307,952 V119E probably damaging Het
Trf A T 9: 103,227,978 M45K probably damaging Het
Trim45 T C 3: 100,929,919 C524R probably damaging Het
Ttc27 G A 17: 74,742,977 V293I probably damaging Het
Ugt1a6b C T 1: 88,107,227 R96C possibly damaging Het
Vit A G 17: 78,586,835 Q222R probably benign Het
Zfp148 T A 16: 33,496,224 V380D probably damaging Het
Other mutations in Mia3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1037:Mia3 UTSW 1 183357354 missense probably benign 0.06
R1489:Mia3 UTSW 1 183338674 missense probably benign
R1997:Mia3 UTSW 1 183344286 missense possibly damaging 0.72
R2261:Mia3 UTSW 1 183334793 missense probably benign 0.00
R2263:Mia3 UTSW 1 183334793 missense probably benign 0.00
R2334:Mia3 UTSW 1 183334402 critical splice donor site probably null
R3417:Mia3 UTSW 1 183362100 missense probably damaging 1.00
R3872:Mia3 UTSW 1 183356998 missense probably benign 0.04
R3943:Mia3 UTSW 1 183358783 missense possibly damaging 0.54
R4398:Mia3 UTSW 1 183330878 missense probably damaging 1.00
R4746:Mia3 UTSW 1 183345220 missense possibly damaging 0.80
R4814:Mia3 UTSW 1 183332830 missense probably damaging 0.98
R4975:Mia3 UTSW 1 183331115 missense probably benign 0.02
R5104:Mia3 UTSW 1 183338132 missense probably damaging 0.98
R5174:Mia3 UTSW 1 183331493 nonsense probably null
R5445:Mia3 UTSW 1 183336022 missense probably benign 0.06
R5651:Mia3 UTSW 1 183358654 missense probably damaging 1.00
R5852:Mia3 UTSW 1 183332859 missense probably benign 0.01
R6246:Mia3 UTSW 1 183345277 missense probably damaging 0.99
R6565:Mia3 UTSW 1 183331485 missense probably damaging 1.00
R7353:Mia3 UTSW 1 183327392 missense
R7378:Mia3 UTSW 1 183334775 missense probably benign 0.01
R7417:Mia3 UTSW 1 183327653 missense
R7442:Mia3 UTSW 1 183358876 missense probably benign 0.03
R7552:Mia3 UTSW 1 183365695 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGTGCTCAGAAAAGTGGG -3'
(R):5'- TCACTGGCAATATGGGGTGAG -3'

Sequencing Primer
(F):5'- AGTGTACTCTTAGCTTTAGTCTCAG -3'
(R):5'- TGAGGTAGTGTTACACTGACAG -3'
Posted On2016-07-06