Incidental Mutation 'R5272:Fnbp4'
ID400385
Institutional Source Beutler Lab
Gene Symbol Fnbp4
Ensembl Gene ENSMUSG00000008200
Gene Nameformin binding protein 4
SynonymsFBP30
MMRRC Submission 042836-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.892) question?
Stock #R5272 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location90745370-90781021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90753115 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 327 (M327I)
Ref Sequence ENSEMBL: ENSMUSP00000013759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013759]
Predicted Effect probably benign
Transcript: ENSMUST00000013759
AA Change: M327I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000013759
Gene: ENSMUSG00000008200
AA Change: M327I

DomainStartEndE-ValueType
low complexity region 65 140 N/A INTRINSIC
low complexity region 165 175 N/A INTRINSIC
low complexity region 204 235 N/A INTRINSIC
WW 265 298 3.58e-5 SMART
low complexity region 372 381 N/A INTRINSIC
low complexity region 386 393 N/A INTRINSIC
low complexity region 404 416 N/A INTRINSIC
coiled coil region 442 478 N/A INTRINSIC
low complexity region 515 533 N/A INTRINSIC
WW 650 683 1.77e-9 SMART
low complexity region 757 788 N/A INTRINSIC
low complexity region 891 909 N/A INTRINSIC
low complexity region 955 1002 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123314
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152794
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A G 3: 32,718,610 E245G probably damaging Het
Arsb A T 13: 93,794,162 T213S possibly damaging Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Cep152 G A 2: 125,611,030 T374I probably benign Het
Crx C T 7: 15,868,285 C156Y probably damaging Het
Csmd1 T A 8: 16,199,944 T1007S probably damaging Het
Cyp19a1 A T 9: 54,176,614 C164S probably benign Het
Ddx55 A T 5: 124,558,029 I137F possibly damaging Het
Dgkg C A 16: 22,588,294 probably null Het
Dicer1 A G 12: 104,704,240 I1022T probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Dnah5 T C 15: 28,350,665 V2611A probably benign Het
Dnah6 A G 6: 73,127,861 probably null Het
Ercc6 A T 14: 32,519,028 K170* probably null Het
Fibcd1 A T 2: 31,816,623 C399S probably damaging Het
Fibcd1 G T 2: 31,816,624 N398K probably damaging Het
Fryl A T 5: 73,065,136 L256* probably null Het
Galr1 T A 18: 82,405,636 Y172F probably benign Het
Gpi1 T C 7: 34,220,690 N186S probably damaging Het
Kcnh8 A G 17: 52,905,015 I614V probably damaging Het
Krt23 A T 11: 99,478,273 I398N probably damaging Het
Mia3 G A 1: 183,328,270 R656* probably null Het
Mup6 G C 4: 60,005,922 G138A probably damaging Het
Nectin3 A G 16: 46,448,476 V521A possibly damaging Het
Nphs1 A G 7: 30,481,642 E1096G possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Panx1 C T 9: 15,044,856 probably null Het
Pcdhb4 A G 18: 37,307,766 Y43C probably benign Het
Plbd1 A G 6: 136,640,158 Y62H probably damaging Het
Rab40b A G 11: 121,357,308 V190A probably damaging Het
Ryr3 T C 2: 112,653,213 E4063G probably damaging Het
Smlr1 T C 10: 25,536,027 I21V probably benign Het
Tenm4 T A 7: 96,874,203 Y1614N probably damaging Het
Tesmin C A 19: 3,406,992 A257E probably damaging Het
Tgif1 A G 17: 70,846,254 L34P probably damaging Het
Ticrr C A 7: 79,669,605 T446K probably benign Het
Tmc7 A G 7: 118,561,053 I187T probably benign Het
Tpst2 T A 5: 112,307,952 V119E probably damaging Het
Trf A T 9: 103,227,978 M45K probably damaging Het
Trim45 T C 3: 100,929,919 C524R probably damaging Het
Ttc27 G A 17: 74,742,977 V293I probably damaging Het
Ugt1a6b C T 1: 88,107,227 R96C possibly damaging Het
Vit A G 17: 78,586,835 Q222R probably benign Het
Zfp148 T A 16: 33,496,224 V380D probably damaging Het
Other mutations in Fnbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Fnbp4 APN 2 90751622 splice site probably benign
IGL00731:Fnbp4 APN 2 90768643 missense probably benign
IGL01021:Fnbp4 APN 2 90777669 missense probably benign 0.06
IGL01097:Fnbp4 APN 2 90776350 missense possibly damaging 0.63
IGL02504:Fnbp4 APN 2 90768543 missense probably damaging 1.00
IGL02510:Fnbp4 APN 2 90751475 missense probably benign
IGL02673:Fnbp4 APN 2 90763472 missense probably benign 0.01
IGL03024:Fnbp4 APN 2 90751179 missense probably benign 0.11
IGL03221:Fnbp4 APN 2 90777718 missense possibly damaging 0.65
R0570:Fnbp4 UTSW 2 90752957 missense probably damaging 1.00
R1914:Fnbp4 UTSW 2 90779193 unclassified probably benign
R1925:Fnbp4 UTSW 2 90765843 missense probably damaging 1.00
R2051:Fnbp4 UTSW 2 90757532 missense probably benign 0.05
R2069:Fnbp4 UTSW 2 90758372 missense probably damaging 1.00
R2165:Fnbp4 UTSW 2 90767399 splice site probably null
R2262:Fnbp4 UTSW 2 90757404 missense probably damaging 1.00
R3836:Fnbp4 UTSW 2 90746785 missense probably damaging 1.00
R4077:Fnbp4 UTSW 2 90758477 nonsense probably null
R4356:Fnbp4 UTSW 2 90758339 missense probably damaging 1.00
R4401:Fnbp4 UTSW 2 90746758 missense possibly damaging 0.62
R4491:Fnbp4 UTSW 2 90752968 critical splice donor site probably null
R4914:Fnbp4 UTSW 2 90751169 missense probably benign 0.00
R4981:Fnbp4 UTSW 2 90765830 missense probably damaging 1.00
R5165:Fnbp4 UTSW 2 90777657 missense possibly damaging 0.65
R5683:Fnbp4 UTSW 2 90752862 missense probably damaging 1.00
R5860:Fnbp4 UTSW 2 90757482 missense probably benign 0.00
R5905:Fnbp4 UTSW 2 90751134 missense probably benign 0.29
R5914:Fnbp4 UTSW 2 90774793 intron probably benign
R6028:Fnbp4 UTSW 2 90751134 missense probably benign 0.29
R6270:Fnbp4 UTSW 2 90757463 missense probably damaging 1.00
R6379:Fnbp4 UTSW 2 90751124 missense probably benign 0.41
R6389:Fnbp4 UTSW 2 90745535 missense unknown
R6883:Fnbp4 UTSW 2 90745828 critical splice donor site probably null
R6940:Fnbp4 UTSW 2 90745514 missense unknown
R7242:Fnbp4 UTSW 2 90745796 missense unknown
R7393:Fnbp4 UTSW 2 90779316 missense probably damaging 0.99
R7454:Fnbp4 UTSW 2 90777815 unclassified probably benign
R7455:Fnbp4 UTSW 2 90777815 unclassified probably benign
R8051:Fnbp4 UTSW 2 90777739 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AGGGATTACAACATTACCAGCC -3'
(R):5'- GGAATCGCTGACATGGTTGG -3'

Sequencing Primer
(F):5'- AGCCCAGGTAATTCTAGAACTG -3'
(R):5'- TGCTGTCTAAGACACAGAGAC -3'
Posted On2016-07-06