Incidental Mutation 'R5272:Actl6a'
ID400391
Institutional Source Beutler Lab
Gene Symbol Actl6a
Ensembl Gene ENSMUSG00000027671
Gene Nameactin-like 6A
Synonyms2810432C06Rik, Baf53a, ARP4, Actl6
MMRRC Submission 042836-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5272 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location32706298-32726973 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32718610 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 245 (E245G)
Ref Sequence ENSEMBL: ENSMUSP00000141543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029214] [ENSMUST00000126144] [ENSMUST00000193615] [ENSMUST00000194781]
Predicted Effect probably benign
Transcript: ENSMUST00000029214
AA Change: E241G

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000029214
Gene: ENSMUSG00000027671
AA Change: E241G

DomainStartEndE-ValueType
ACTIN 11 429 1.37e-189 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126144
AA Change: E189G

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000114317
Gene: ENSMUSG00000027671
AA Change: E189G

DomainStartEndE-ValueType
ACTIN 1 204 4.28e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153779
Predicted Effect probably benign
Transcript: ENSMUST00000193231
Predicted Effect probably benign
Transcript: ENSMUST00000193615
SMART Domains Protein: ENSMUSP00000141354
Gene: ENSMUSG00000027671

DomainStartEndE-ValueType
Pfam:Actin 8 60 1.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194497
Predicted Effect probably damaging
Transcript: ENSMUST00000194781
AA Change: E245G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141543
Gene: ENSMUSG00000027671
AA Change: E245G

DomainStartEndE-ValueType
ACTIN 15 245 1.5e-32 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a family member of actin-related proteins (ARPs), which share significant amino acid sequence identity to conventional actins. Both actins and ARPs have an actin fold, which is an ATP-binding cleft, as a common feature. The ARPs are involved in diverse cellular processes, including vesicular transport, spindle orientation, nuclear migration and chromatin remodeling. This gene encodes a 53 kDa subunit protein of the BAF (BRG1/brm-associated factor) complex in mammals, which is functionally related to SWI/SNF complex in S. cerevisiae and Drosophila; the latter is thought to facilitate transcriptional activation of specific genes by antagonizing chromatin-mediated transcriptional repression. Together with beta-actin, it is required for maximal ATPase activity of BRG1, and for the association of the BAF complex with chromatin/matrix. Three transcript variants that encode two different protein isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality before E6.5. Mice homozygous for a conditional allele activated in hematopoietic cells exhibit bone marrow failure and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arsb A T 13: 93,794,162 T213S possibly damaging Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Cep152 G A 2: 125,611,030 T374I probably benign Het
Crx C T 7: 15,868,285 C156Y probably damaging Het
Csmd1 T A 8: 16,199,944 T1007S probably damaging Het
Cyp19a1 A T 9: 54,176,614 C164S probably benign Het
Ddx55 A T 5: 124,558,029 I137F possibly damaging Het
Dgkg C A 16: 22,588,294 probably null Het
Dicer1 A G 12: 104,704,240 I1022T probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Dnah5 T C 15: 28,350,665 V2611A probably benign Het
Dnah6 A G 6: 73,127,861 probably null Het
Ercc6 A T 14: 32,519,028 K170* probably null Het
Fibcd1 A T 2: 31,816,623 C399S probably damaging Het
Fibcd1 G T 2: 31,816,624 N398K probably damaging Het
Fnbp4 G A 2: 90,753,115 M327I probably benign Het
Fryl A T 5: 73,065,136 L256* probably null Het
Galr1 T A 18: 82,405,636 Y172F probably benign Het
Gpi1 T C 7: 34,220,690 N186S probably damaging Het
Kcnh8 A G 17: 52,905,015 I614V probably damaging Het
Krt23 A T 11: 99,478,273 I398N probably damaging Het
Mia3 G A 1: 183,328,270 R656* probably null Het
Mup6 G C 4: 60,005,922 G138A probably damaging Het
Nectin3 A G 16: 46,448,476 V521A possibly damaging Het
Nphs1 A G 7: 30,481,642 E1096G possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Panx1 C T 9: 15,044,856 probably null Het
Pcdhb4 A G 18: 37,307,766 Y43C probably benign Het
Plbd1 A G 6: 136,640,158 Y62H probably damaging Het
Rab40b A G 11: 121,357,308 V190A probably damaging Het
Ryr3 T C 2: 112,653,213 E4063G probably damaging Het
Smlr1 T C 10: 25,536,027 I21V probably benign Het
Tenm4 T A 7: 96,874,203 Y1614N probably damaging Het
Tesmin C A 19: 3,406,992 A257E probably damaging Het
Tgif1 A G 17: 70,846,254 L34P probably damaging Het
Ticrr C A 7: 79,669,605 T446K probably benign Het
Tmc7 A G 7: 118,561,053 I187T probably benign Het
Tpst2 T A 5: 112,307,952 V119E probably damaging Het
Trf A T 9: 103,227,978 M45K probably damaging Het
Trim45 T C 3: 100,929,919 C524R probably damaging Het
Ttc27 G A 17: 74,742,977 V293I probably damaging Het
Ugt1a6b C T 1: 88,107,227 R96C possibly damaging Het
Vit A G 17: 78,586,835 Q222R probably benign Het
Zfp148 T A 16: 33,496,224 V380D probably damaging Het
Other mutations in Actl6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Actl6a APN 3 32712164 missense probably benign 0.01
IGL01691:Actl6a APN 3 32720200 missense possibly damaging 0.94
IGL02902:Actl6a APN 3 32722642 missense possibly damaging 0.93
R0194:Actl6a UTSW 3 32725320 missense probably damaging 1.00
R1193:Actl6a UTSW 3 32712144 missense probably benign 0.00
R1404:Actl6a UTSW 3 32722610 unclassified probably benign
R1754:Actl6a UTSW 3 32718574 missense probably damaging 1.00
R4289:Actl6a UTSW 3 32712114 missense possibly damaging 0.87
R5020:Actl6a UTSW 3 32720507 missense possibly damaging 0.79
R5165:Actl6a UTSW 3 32720208 missense probably benign 0.01
R5384:Actl6a UTSW 3 32720493 missense probably damaging 1.00
R5640:Actl6a UTSW 3 32718050 missense probably damaging 0.99
R5722:Actl6a UTSW 3 32718045 missense probably damaging 0.97
R5865:Actl6a UTSW 3 32712128 missense possibly damaging 0.80
R6208:Actl6a UTSW 3 32711894 missense probably benign 0.05
R7094:Actl6a UTSW 3 32706338 start gained probably benign
R7192:Actl6a UTSW 3 32720224 missense probably damaging 1.00
R7866:Actl6a UTSW 3 32712113 missense possibly damaging 0.87
R7949:Actl6a UTSW 3 32712113 missense possibly damaging 0.87
Z1176:Actl6a UTSW 3 32726543 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGGAGACTTCATTACCATGCAG -3'
(R):5'- ATAACATGGCCGTCTCTGTCC -3'

Sequencing Primer
(F):5'- TGCAGTGCAGAGAACTCTTC -3'
(R):5'- TCTCTGTCCAATCCCAAGGCAG -3'
Posted On2016-07-06