Incidental Mutation 'R5272:C77080'
ID400395
Institutional Source Beutler Lab
Gene Symbol C77080
Ensembl Gene ENSMUSG00000050390
Gene Nameexpressed sequence C77080
Synonyms
MMRRC Submission 042836-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R5272 (G1)
Quality Score160
Status Not validated
Chromosome4
Chromosomal Location129219578-129261404 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129224212 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 208 (T208A)
Ref Sequence ENSEMBL: ENSMUSP00000101666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052602] [ENSMUST00000097873] [ENSMUST00000106051] [ENSMUST00000106054] [ENSMUST00000145261] [ENSMUST00000146376]
Predicted Effect probably benign
Transcript: ENSMUST00000052602
AA Change: T265A

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000062395
Gene: ENSMUSG00000050390
AA Change: T265A

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
low complexity region 39 80 N/A INTRINSIC
low complexity region 209 215 N/A INTRINSIC
low complexity region 273 286 N/A INTRINSIC
low complexity region 365 382 N/A INTRINSIC
low complexity region 393 418 N/A INTRINSIC
low complexity region 449 464 N/A INTRINSIC
low complexity region 492 499 N/A INTRINSIC
low complexity region 532 550 N/A INTRINSIC
low complexity region 555 588 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
low complexity region 657 690 N/A INTRINSIC
low complexity region 724 739 N/A INTRINSIC
low complexity region 743 773 N/A INTRINSIC
low complexity region 810 833 N/A INTRINSIC
low complexity region 916 930 N/A INTRINSIC
low complexity region 988 1020 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097873
AA Change: T220A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095483
Gene: ENSMUSG00000050390
AA Change: T220A

DomainStartEndE-ValueType
low complexity region 164 170 N/A INTRINSIC
low complexity region 228 241 N/A INTRINSIC
low complexity region 320 337 N/A INTRINSIC
low complexity region 348 373 N/A INTRINSIC
low complexity region 404 419 N/A INTRINSIC
low complexity region 447 454 N/A INTRINSIC
low complexity region 487 505 N/A INTRINSIC
low complexity region 510 543 N/A INTRINSIC
low complexity region 576 589 N/A INTRINSIC
low complexity region 612 645 N/A INTRINSIC
low complexity region 679 694 N/A INTRINSIC
low complexity region 698 728 N/A INTRINSIC
low complexity region 765 788 N/A INTRINSIC
low complexity region 871 885 N/A INTRINSIC
low complexity region 943 975 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106051
AA Change: T208A

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101666
Gene: ENSMUSG00000050390
AA Change: T208A

DomainStartEndE-ValueType
low complexity region 152 158 N/A INTRINSIC
low complexity region 216 229 N/A INTRINSIC
low complexity region 308 325 N/A INTRINSIC
low complexity region 336 361 N/A INTRINSIC
low complexity region 392 407 N/A INTRINSIC
low complexity region 435 442 N/A INTRINSIC
low complexity region 475 493 N/A INTRINSIC
low complexity region 498 531 N/A INTRINSIC
low complexity region 564 577 N/A INTRINSIC
low complexity region 600 633 N/A INTRINSIC
low complexity region 667 682 N/A INTRINSIC
low complexity region 686 716 N/A INTRINSIC
low complexity region 753 776 N/A INTRINSIC
low complexity region 859 873 N/A INTRINSIC
low complexity region 931 963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106054
SMART Domains Protein: ENSMUSP00000101669
Gene: ENSMUSG00000028811

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:tRNA-synt_1b 67 358 1e-78 PFAM
Pfam:tRNA_bind 406 502 7.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145261
Predicted Effect probably benign
Transcript: ENSMUST00000146376
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A G 3: 32,718,610 E245G probably damaging Het
Arsb A T 13: 93,794,162 T213S possibly damaging Het
Cep152 G A 2: 125,611,030 T374I probably benign Het
Crx C T 7: 15,868,285 C156Y probably damaging Het
Csmd1 T A 8: 16,199,944 T1007S probably damaging Het
Cyp19a1 A T 9: 54,176,614 C164S probably benign Het
Ddx55 A T 5: 124,558,029 I137F possibly damaging Het
Dgkg C A 16: 22,588,294 probably null Het
Dicer1 A G 12: 104,704,240 I1022T probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Dnah5 T C 15: 28,350,665 V2611A probably benign Het
Dnah6 A G 6: 73,127,861 probably null Het
Ercc6 A T 14: 32,519,028 K170* probably null Het
Fibcd1 A T 2: 31,816,623 C399S probably damaging Het
Fibcd1 G T 2: 31,816,624 N398K probably damaging Het
Fnbp4 G A 2: 90,753,115 M327I probably benign Het
Fryl A T 5: 73,065,136 L256* probably null Het
Galr1 T A 18: 82,405,636 Y172F probably benign Het
Gpi1 T C 7: 34,220,690 N186S probably damaging Het
Kcnh8 A G 17: 52,905,015 I614V probably damaging Het
Krt23 A T 11: 99,478,273 I398N probably damaging Het
Mia3 G A 1: 183,328,270 R656* probably null Het
Mup6 G C 4: 60,005,922 G138A probably damaging Het
Nectin3 A G 16: 46,448,476 V521A possibly damaging Het
Nphs1 A G 7: 30,481,642 E1096G possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Panx1 C T 9: 15,044,856 probably null Het
Pcdhb4 A G 18: 37,307,766 Y43C probably benign Het
Plbd1 A G 6: 136,640,158 Y62H probably damaging Het
Rab40b A G 11: 121,357,308 V190A probably damaging Het
Ryr3 T C 2: 112,653,213 E4063G probably damaging Het
Smlr1 T C 10: 25,536,027 I21V probably benign Het
Tenm4 T A 7: 96,874,203 Y1614N probably damaging Het
Tesmin C A 19: 3,406,992 A257E probably damaging Het
Tgif1 A G 17: 70,846,254 L34P probably damaging Het
Ticrr C A 7: 79,669,605 T446K probably benign Het
Tmc7 A G 7: 118,561,053 I187T probably benign Het
Tpst2 T A 5: 112,307,952 V119E probably damaging Het
Trf A T 9: 103,227,978 M45K probably damaging Het
Trim45 T C 3: 100,929,919 C524R probably damaging Het
Ttc27 G A 17: 74,742,977 V293I probably damaging Het
Ugt1a6b C T 1: 88,107,227 R96C possibly damaging Het
Vit A G 17: 78,586,835 Q222R probably benign Het
Zfp148 T A 16: 33,496,224 V380D probably damaging Het
Other mutations in C77080
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:C77080 APN 4 129222796 unclassified probably null
IGL02654:C77080 APN 4 129222319 missense probably damaging 1.00
IGL02797:C77080 APN 4 129223311 missense probably damaging 0.99
IGL03231:C77080 APN 4 129223681 missense possibly damaging 0.73
IGL03134:C77080 UTSW 4 129222487 missense possibly damaging 0.53
R0078:C77080 UTSW 4 129227723 splice site probably null
R0418:C77080 UTSW 4 129223684 missense probably damaging 1.00
R1374:C77080 UTSW 4 129222289 missense possibly damaging 0.83
R1632:C77080 UTSW 4 129222666 missense possibly damaging 0.94
R1735:C77080 UTSW 4 129223577 missense probably damaging 1.00
R1970:C77080 UTSW 4 129226017 splice site probably benign
R2018:C77080 UTSW 4 129222355 missense probably damaging 0.96
R2157:C77080 UTSW 4 129224124 missense possibly damaging 0.76
R2201:C77080 UTSW 4 129222639 missense probably benign
R2316:C77080 UTSW 4 129223747 missense probably damaging 1.00
R3751:C77080 UTSW 4 129224322 unclassified probably benign
R4648:C77080 UTSW 4 129221940 missense probably benign 0.00
R4790:C77080 UTSW 4 129223302 missense probably damaging 1.00
R4885:C77080 UTSW 4 129224445 missense probably damaging 1.00
R5217:C77080 UTSW 4 129222685 missense probably damaging 0.99
R5270:C77080 UTSW 4 129224212 missense possibly damaging 0.48
R5273:C77080 UTSW 4 129224212 missense possibly damaging 0.48
R5314:C77080 UTSW 4 129224212 missense possibly damaging 0.48
R5548:C77080 UTSW 4 129223980 frame shift probably null
R5752:C77080 UTSW 4 129223980 frame shift probably null
R5908:C77080 UTSW 4 129222148 missense probably damaging 0.98
R5960:C77080 UTSW 4 129222072 missense probably damaging 0.99
R7024:C77080 UTSW 4 129225408 missense probably null 0.73
R7296:C77080 UTSW 4 129225418 missense probably damaging 1.00
R7447:C77080 UTSW 4 129222042 missense possibly damaging 0.63
R7638:C77080 UTSW 4 129221941 missense probably benign
R7689:C77080 UTSW 4 129223773 missense probably benign 0.25
R7819:C77080 UTSW 4 129222483 missense probably benign 0.31
Z1088:C77080 UTSW 4 129222298 missense probably damaging 1.00
Z1176:C77080 UTSW 4 129223704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCACTGCGAGAGACATTG -3'
(R):5'- CCATGACTCATTTCCCAAATCTGG -3'

Sequencing Primer
(F):5'- AGAGACATTGGCCTCGTCAGTG -3'
(R):5'- CCTCAGCACGTGCAGAAG -3'
Posted On2016-07-06