Incidental Mutation 'R5197:Cyp39a1'
ID400407
Institutional Source Beutler Lab
Gene Symbol Cyp39a1
Ensembl Gene ENSMUSG00000023963
Gene Namecytochrome P450, family 39, subfamily a, polypeptide 1
Synonymsoxysterol 7-alpha-hydroxylase
MMRRC Submission 042773-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R5197 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location43667425-43751431 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 43746538 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 423 (L423V)
Ref Sequence ENSEMBL: ENSMUSP00000130073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170988]
Predicted Effect possibly damaging
Transcript: ENSMUST00000170988
AA Change: L423V

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130073
Gene: ENSMUSG00000023963
AA Change: L423V

DomainStartEndE-ValueType
Pfam:p450 32 464 1.9e-52 PFAM
Meta Mutation Damage Score 0.2493 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein is involved in the conversion of cholesterol to bile acids. Its substrates include the oxysterols 25-hydroxycholesterol, 27-hydroxycholesterol and 24-hydroxycholesterol. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg1 T C 9: 54,622,582 E247G possibly damaging Het
Adgra3 A G 5: 49,960,754 F1151L probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Aldh4a1 A C 4: 139,648,301 probably benign Het
Anln A T 9: 22,352,781 probably null Het
Aste1 T C 9: 105,405,054 S74P probably damaging Het
Atp6v0e2 G A 6: 48,540,117 R77H probably benign Het
Brpf1 A G 6: 113,319,941 D962G possibly damaging Het
Btbd2 T C 10: 80,646,419 D249G probably damaging Het
Catsper3 T C 13: 55,808,176 probably null Het
Cfap43 A G 19: 47,897,372 L268P probably damaging Het
Cftr T C 6: 18,255,414 V540A probably benign Het
Col22a1 C T 15: 72,009,406 G32D probably damaging Het
Col5a2 G T 1: 45,393,081 P804Q probably benign Het
Cyp2d41-ps A G 15: 82,778,780 noncoding transcript Het
Elmo1 T G 13: 20,564,437 V484G probably benign Het
Eps8 C A 6: 137,490,290 Q656H probably damaging Het
Eps8 T C 6: 137,490,291 Q656R possibly damaging Het
Fam71f2 G T 6: 29,281,222 probably benign Het
Fshb T C 2: 107,057,509 D55G possibly damaging Het
Gm13089 A C 4: 143,698,062 C270W possibly damaging Het
Herc1 C A 9: 66,448,504 Q2346K probably damaging Het
Hist1h3d T A 13: 23,576,130 L110Q probably damaging Het
Htr3b T C 9: 48,945,515 D221G probably benign Het
Ift74 T A 4: 94,662,596 D328E probably benign Het
Kif21b A T 1: 136,144,625 K23M probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lipc T A 9: 70,798,391 E470V probably benign Het
Lrrc4 G T 6: 28,830,143 T68K probably damaging Het
Lrrc63 T A 14: 75,084,882 H594L possibly damaging Het
Mfsd14a A T 3: 116,648,501 probably benign Het
Mob2 T C 7: 142,009,537 probably null Het
Nckap5 T A 1: 126,222,673 H105L possibly damaging Het
Ngef C A 1: 87,509,368 G133* probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1000 T C 2: 85,608,447 I154M probably benign Het
Olfr113 T G 17: 37,575,220 I68L probably benign Het
Olfr1477 G T 19: 13,502,384 V14F possibly damaging Het
Olfr31 T A 14: 14,328,462 M117K probably damaging Het
Olfr593 G A 7: 103,212,000 V47I probably benign Het
Pard3 A G 8: 127,073,290 probably null Het
Pgm1 C T 5: 64,105,832 A274V possibly damaging Het
Ppp1r9a T A 6: 5,156,177 S1144R probably damaging Het
Prkcq C T 2: 11,299,416 P590L probably damaging Het
Psmd13 T A 7: 140,894,461 probably null Het
Rab3gap1 T A 1: 127,889,194 D63E probably benign Het
Rag2 C A 2: 101,630,740 T465K probably damaging Het
Rnase6 A G 14: 51,130,213 M21V unknown Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 A T 13: 11,638,430 probably null Het
Sash1 T G 10: 8,740,225 R624S probably damaging Het
Slc1a2 A G 2: 102,756,115 I355V probably benign Het
Srrm2 T C 17: 23,817,384 S1097P probably benign Het
Sugct C T 13: 17,323,276 A271T probably damaging Het
Tdrd7 T C 4: 46,034,350 V1065A probably damaging Het
Tmprss6 T A 15: 78,454,189 Y307F probably damaging Het
Tram1 T C 1: 13,571,902 N216S probably benign Het
Ttk T C 9: 83,839,341 V93A probably benign Het
Ubr4 A G 4: 139,468,097 Y1210C probably damaging Het
Wdr7 A G 18: 63,738,866 K364E probably benign Het
Xrcc2 G T 5: 25,692,658 H98N probably benign Het
Zdhhc11 A G 13: 73,965,569 I77V probably benign Het
Zfp54 C T 17: 21,434,180 S312L probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Cyp39a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Cyp39a1 APN 17 43701543 missense probably benign 0.01
IGL01070:Cyp39a1 APN 17 43683022 missense probably benign 0.00
IGL01606:Cyp39a1 APN 17 43746618 splice site probably benign
IGL01769:Cyp39a1 APN 17 43749915 missense possibly damaging 0.53
IGL01916:Cyp39a1 APN 17 43731050 missense probably damaging 1.00
IGL02374:Cyp39a1 APN 17 43749981 utr 3 prime probably benign
IGL02402:Cyp39a1 APN 17 43691722 missense probably benign 0.07
IGL03097:Cyp39a1 UTSW 17 43683050 nonsense probably null
R0230:Cyp39a1 UTSW 17 43732012 missense probably damaging 1.00
R1244:Cyp39a1 UTSW 17 43749945 missense probably benign 0.13
R1572:Cyp39a1 UTSW 17 43680129 missense probably damaging 1.00
R1656:Cyp39a1 UTSW 17 43667619 missense possibly damaging 0.74
R4036:Cyp39a1 UTSW 17 43676940 missense probably damaging 0.97
R4308:Cyp39a1 UTSW 17 43730964 splice site probably null
R5081:Cyp39a1 UTSW 17 43746597 missense probably damaging 1.00
R5405:Cyp39a1 UTSW 17 43676940 missense probably damaging 1.00
R5566:Cyp39a1 UTSW 17 43685208 missense possibly damaging 0.92
R5578:Cyp39a1 UTSW 17 43680140 missense possibly damaging 0.91
R6045:Cyp39a1 UTSW 17 43731991 missense probably damaging 1.00
R6495:Cyp39a1 UTSW 17 43691694 missense probably benign 0.41
R7191:Cyp39a1 UTSW 17 43731019 nonsense probably null
R7431:Cyp39a1 UTSW 17 43683015 missense probably benign
R7522:Cyp39a1 UTSW 17 43667479 start gained probably benign
R7620:Cyp39a1 UTSW 17 43725653 splice site probably null
R8022:Cyp39a1 UTSW 17 43746577 missense probably damaging 1.00
R8143:Cyp39a1 UTSW 17 43725626 missense probably benign 0.39
Z1176:Cyp39a1 UTSW 17 43725577 missense probably benign 0.01
Z1176:Cyp39a1 UTSW 17 43731048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATATGTGCATGCATGTATCTGTG -3'
(R):5'- GGTCATCACTCAACACATGGC -3'

Sequencing Primer
(F):5'- GTTCTAGCCTCTCAGAGCACATAC -3'
(R):5'- CACATGGCTAGTATTAAAAGCCAG -3'
Posted On2016-07-06