Incidental Mutation 'R5272:Gpi1'
List |< first << previous [record 20 of 45] next >> last >|
ID400411
Institutional Source Beutler Lab
Gene Symbol Gpi1
Ensembl Gene ENSMUSG00000036427
Gene Nameglucose phosphate isomerase 1
Synonymsneuroleukin, MF, Gpi-1t, Gpi-1s, Gpi-1r, maturation factor, Org, NK, NK/GPI, Gpi-1, AMF, Gpi1-t, Gpi1-s, Gpi1-r, autocrine motility factor
MMRRC Submission 042836-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5272 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location34201330-34230336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34220690 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 186 (N186S)
Ref Sequence ENSEMBL: ENSMUSP00000049355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038027] [ENSMUST00000205983] [ENSMUST00000206415]
PDB Structure
Crystal structure of mouse phosphoglucose isomerase [X-RAY DIFFRACTION]
Crystal structure of mouse phosphoglucose isomerase in complex with glucose 6-phosphate [X-RAY DIFFRACTION]
Crystal structure of mouse phosphoglucose isomerase in complex with erythrose 4-phosphate [X-RAY DIFFRACTION]
Crystal structure of mouse AMF [X-RAY DIFFRACTION]
Crystal structure of mouse AMF / phosphate complex [X-RAY DIFFRACTION]
Crystal structure of mouse AMF / E4P complex [X-RAY DIFFRACTION]
Crystal structure of mouse AMF / A5P complex [X-RAY DIFFRACTION]
Crystal structure of mouse AMF / S6P complex [X-RAY DIFFRACTION]
Crystal structure of mouse AMF / 6PG complex [X-RAY DIFFRACTION]
Crystal structure of mouse AMF / F6P complex [X-RAY DIFFRACTION]
>> 2 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000038027
AA Change: N186S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049355
Gene: ENSMUSG00000036427
AA Change: N186S

DomainStartEndE-ValueType
Pfam:PGI 54 546 1e-265 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180864
Predicted Effect probably benign
Transcript: ENSMUST00000205800
Predicted Effect probably benign
Transcript: ENSMUST00000205983
Predicted Effect probably benign
Transcript: ENSMUST00000206415
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206603
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the glucose phosphate isomerase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. In the cytoplasm, the gene product functions as a glycolytic enzyme (glucose-6-phosphate isomerase) that interconverts glucose-6-phosphate and fructose-6-phosphate. Extracellularly, the encoded protein (also referred to as neuroleukin) functions as a neurotrophic factor that promotes survival of skeletal motor neurons and sensory neurons, and as a lymphokine that induces immunoglobulin secretion. The encoded protein is also referred to as autocrine motility factor based on an additional function as a tumor-secreted cytokine and angiogenic factor. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygotes for null mutations fail to develop beyond the egg cylinder stage and die by embryonic day 9.5. Homozygotes for a hypomorphic mutation exhibit nonspherocytic hemolytic anemia with hepatosplenomegaly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A G 3: 32,718,610 E245G probably damaging Het
Arsb A T 13: 93,794,162 T213S possibly damaging Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Cep152 G A 2: 125,611,030 T374I probably benign Het
Crx C T 7: 15,868,285 C156Y probably damaging Het
Csmd1 T A 8: 16,199,944 T1007S probably damaging Het
Cyp19a1 A T 9: 54,176,614 C164S probably benign Het
Ddx55 A T 5: 124,558,029 I137F possibly damaging Het
Dgkg C A 16: 22,588,294 probably null Het
Dicer1 A G 12: 104,704,240 I1022T probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Dnah5 T C 15: 28,350,665 V2611A probably benign Het
Dnah6 A G 6: 73,127,861 probably null Het
Ercc6 A T 14: 32,519,028 K170* probably null Het
Fibcd1 A T 2: 31,816,623 C399S probably damaging Het
Fibcd1 G T 2: 31,816,624 N398K probably damaging Het
Fnbp4 G A 2: 90,753,115 M327I probably benign Het
Fryl A T 5: 73,065,136 L256* probably null Het
Galr1 T A 18: 82,405,636 Y172F probably benign Het
Kcnh8 A G 17: 52,905,015 I614V probably damaging Het
Krt23 A T 11: 99,478,273 I398N probably damaging Het
Mia3 G A 1: 183,328,270 R656* probably null Het
Mup6 G C 4: 60,005,922 G138A probably damaging Het
Nectin3 A G 16: 46,448,476 V521A possibly damaging Het
Nphs1 A G 7: 30,481,642 E1096G possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Panx1 C T 9: 15,044,856 probably null Het
Pcdhb4 A G 18: 37,307,766 Y43C probably benign Het
Plbd1 A G 6: 136,640,158 Y62H probably damaging Het
Rab40b A G 11: 121,357,308 V190A probably damaging Het
Ryr3 T C 2: 112,653,213 E4063G probably damaging Het
Smlr1 T C 10: 25,536,027 I21V probably benign Het
Tenm4 T A 7: 96,874,203 Y1614N probably damaging Het
Tesmin C A 19: 3,406,992 A257E probably damaging Het
Tgif1 A G 17: 70,846,254 L34P probably damaging Het
Ticrr C A 7: 79,669,605 T446K probably benign Het
Tmc7 A G 7: 118,561,053 I187T probably benign Het
Tpst2 T A 5: 112,307,952 V119E probably damaging Het
Trf A T 9: 103,227,978 M45K probably damaging Het
Trim45 T C 3: 100,929,919 C524R probably damaging Het
Ttc27 G A 17: 74,742,977 V293I probably damaging Het
Ugt1a6b C T 1: 88,107,227 R96C possibly damaging Het
Vit A G 17: 78,586,835 Q222R probably benign Het
Zfp148 T A 16: 33,496,224 V380D probably damaging Het
Other mutations in Gpi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Gpi1 APN 7 34215950 intron probably benign
IGL01911:Gpi1 APN 7 34220922 missense probably damaging 1.00
IGL02155:Gpi1 APN 7 34230189 missense possibly damaging 0.94
R0019:Gpi1 UTSW 7 34220899 missense probably damaging 0.99
R1413:Gpi1 UTSW 7 34230155 missense probably benign 0.22
R1974:Gpi1 UTSW 7 34220803 intron probably null
R2132:Gpi1 UTSW 7 34205914 missense probably damaging 1.00
R2254:Gpi1 UTSW 7 34202877 missense probably damaging 1.00
R2255:Gpi1 UTSW 7 34202877 missense probably damaging 1.00
R2435:Gpi1 UTSW 7 34205829 missense probably damaging 1.00
R2509:Gpi1 UTSW 7 34205923 missense probably damaging 1.00
R2510:Gpi1 UTSW 7 34205923 missense probably damaging 1.00
R3408:Gpi1 UTSW 7 34202679 missense probably damaging 0.99
R5059:Gpi1 UTSW 7 34207688 missense probably damaging 1.00
R5141:Gpi1 UTSW 7 34227096 intron probably benign
R5980:Gpi1 UTSW 7 34228926 critical splice donor site probably null
R6261:Gpi1 UTSW 7 34220745 missense possibly damaging 0.93
R6788:Gpi1 UTSW 7 34228990 missense probably damaging 1.00
R6835:Gpi1 UTSW 7 34227138 missense possibly damaging 0.89
R6989:Gpi1 UTSW 7 34202520 missense probably damaging 1.00
R8008:Gpi1 UTSW 7 34218301 missense probably damaging 1.00
RF012:Gpi1 UTSW 7 34202477 missense probably damaging 1.00
Z1177:Gpi1 UTSW 7 34205645 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AAGCATCTAAGGGCAGCTGTG -3'
(R):5'- GTACACTGGCAAATCCATCACG -3'

Sequencing Primer
(F):5'- GCTGTGCTAACCAGATCCAC -3'
(R):5'- TCATCAACATCGGCATCGGG -3'
Posted On2016-07-06