Incidental Mutation 'R5272:Trf'
List |< first << previous [record 40 of 45] next >> last >|
ID400423
Institutional Source Beutler Lab
Gene Symbol Trf
Ensembl Gene ENSMUSG00000032554
Gene Nametransferrin
SynonymsHP, Tfn
MMRRC Submission 042836-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5272 (G1)
Quality Score119
Status Not validated
Chromosome9
Chromosomal Location103204001-103230444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103227978 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 45 (M45K)
Ref Sequence ENSEMBL: ENSMUSP00000129013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035158] [ENSMUST00000112645] [ENSMUST00000126359] [ENSMUST00000164377] [ENSMUST00000165296] [ENSMUST00000166836]
Predicted Effect probably damaging
Transcript: ENSMUST00000035158
AA Change: M45K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035158
Gene: ENSMUSG00000032554
AA Change: M45K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 25 352 5.04e-194 SMART
TR_FER 360 686 8.64e-193 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112645
AA Change: M45K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108264
Gene: ENSMUSG00000032554
AA Change: M45K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 25 352 5.04e-194 SMART
TR_FER 360 686 8.64e-193 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126359
AA Change: M42K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120472
Gene: ENSMUSG00000032554
AA Change: M42K

DomainStartEndE-ValueType
TR_FER 22 237 2.25e-77 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164377
AA Change: M45K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128647
Gene: ENSMUSG00000032554
AA Change: M45K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Transferrin 25 72 6.6e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165296
AA Change: M45K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129013
Gene: ENSMUSG00000032554
AA Change: M45K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 25 171 5.58e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166836
AA Change: M45K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127808
Gene: ENSMUSG00000090639
AA Change: M45K

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
TR_FER 25 338 4.98e-175 SMART
TR_FER 346 672 8.64e-193 SMART
Pfam:Arf 758 928 1.5e-15 PFAM
Pfam:SRPRB 769 948 1.4e-73 PFAM
Pfam:MMR_HSR1 773 888 7.8e-8 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein with an approximate molecular weight of 76.5 kDa. It is thought to have been created as a result of an ancient gene duplication event that led to generation of homologous C and N-terminal domains each of which binds one ion of ferric iron. The function of this protein is to transport iron from the intestine, reticuloendothelial system, and liver parenchymal cells to all proliferating cells in the body. This protein may also have a physiologic role as granulocyte/pollen-binding protein (GPBP) involved in the removal of certain organic matter and allergens from serum. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit refractory iron-deficient, hypochromic, microcytic anemia with iron-loading in the liver, pancreas, heart and brain. Mutants usually die by two weeks of age. Heterozygotes show minor increases in iron stores. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A G 3: 32,718,610 E245G probably damaging Het
Arsb A T 13: 93,794,162 T213S possibly damaging Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Cep152 G A 2: 125,611,030 T374I probably benign Het
Crx C T 7: 15,868,285 C156Y probably damaging Het
Csmd1 T A 8: 16,199,944 T1007S probably damaging Het
Cyp19a1 A T 9: 54,176,614 C164S probably benign Het
Ddx55 A T 5: 124,558,029 I137F possibly damaging Het
Dgkg C A 16: 22,588,294 probably null Het
Dicer1 A G 12: 104,704,240 I1022T probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Dnah5 T C 15: 28,350,665 V2611A probably benign Het
Dnah6 A G 6: 73,127,861 probably null Het
Ercc6 A T 14: 32,519,028 K170* probably null Het
Fibcd1 A T 2: 31,816,623 C399S probably damaging Het
Fibcd1 G T 2: 31,816,624 N398K probably damaging Het
Fnbp4 G A 2: 90,753,115 M327I probably benign Het
Fryl A T 5: 73,065,136 L256* probably null Het
Galr1 T A 18: 82,405,636 Y172F probably benign Het
Gpi1 T C 7: 34,220,690 N186S probably damaging Het
Kcnh8 A G 17: 52,905,015 I614V probably damaging Het
Krt23 A T 11: 99,478,273 I398N probably damaging Het
Mia3 G A 1: 183,328,270 R656* probably null Het
Mup6 G C 4: 60,005,922 G138A probably damaging Het
Nectin3 A G 16: 46,448,476 V521A possibly damaging Het
Nphs1 A G 7: 30,481,642 E1096G possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Panx1 C T 9: 15,044,856 probably null Het
Pcdhb4 A G 18: 37,307,766 Y43C probably benign Het
Plbd1 A G 6: 136,640,158 Y62H probably damaging Het
Rab40b A G 11: 121,357,308 V190A probably damaging Het
Ryr3 T C 2: 112,653,213 E4063G probably damaging Het
Smlr1 T C 10: 25,536,027 I21V probably benign Het
Tenm4 T A 7: 96,874,203 Y1614N probably damaging Het
Tesmin C A 19: 3,406,992 A257E probably damaging Het
Tgif1 A G 17: 70,846,254 L34P probably damaging Het
Ticrr C A 7: 79,669,605 T446K probably benign Het
Tmc7 A G 7: 118,561,053 I187T probably benign Het
Tpst2 T A 5: 112,307,952 V119E probably damaging Het
Trim45 T C 3: 100,929,919 C524R probably damaging Het
Ttc27 G A 17: 74,742,977 V293I probably damaging Het
Ugt1a6b C T 1: 88,107,227 R96C possibly damaging Het
Vit A G 17: 78,586,835 Q222R probably benign Het
Zfp148 T A 16: 33,496,224 V380D probably damaging Het
Other mutations in Trf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Trf APN 9 103220957 missense probably benign 0.00
IGL00424:Trf APN 9 103226936 missense probably damaging 1.00
IGL00793:Trf APN 9 103226143 unclassified probably benign
IGL01139:Trf APN 9 103223604 missense probably damaging 1.00
IGL01658:Trf APN 9 103226856 missense probably benign 0.04
IGL02671:Trf APN 9 103211982 missense probably benign 0.01
IGL02996:Trf APN 9 103220903 missense probably benign 0.01
R0060:Trf UTSW 9 103220922 missense probably benign 0.11
R0060:Trf UTSW 9 103220922 missense probably benign 0.11
R0096:Trf UTSW 9 103222159 missense probably damaging 1.00
R0096:Trf UTSW 9 103222159 missense probably damaging 1.00
R0112:Trf UTSW 9 103226956 unclassified probably benign
R0234:Trf UTSW 9 103226879 unclassified probably null
R0234:Trf UTSW 9 103226879 unclassified probably null
R0411:Trf UTSW 9 103217501 missense probably damaging 1.00
R0456:Trf UTSW 9 103226903 missense probably damaging 1.00
R0601:Trf UTSW 9 103222933 critical splice donor site probably null
R1419:Trf UTSW 9 103226108 missense probably damaging 1.00
R1606:Trf UTSW 9 103225136 splice site probably null
R3943:Trf UTSW 9 103222952 missense probably benign 0.00
R4431:Trf UTSW 9 103211876 missense possibly damaging 0.81
R4609:Trf UTSW 9 103211985 missense possibly damaging 0.81
R4658:Trf UTSW 9 103223608 missense probably damaging 1.00
R4830:Trf UTSW 9 103227915 missense probably damaging 0.98
R4925:Trf UTSW 9 103219246 missense probably benign 0.00
R4929:Trf UTSW 9 103227875 intron probably benign
R4931:Trf UTSW 9 103228048 missense probably damaging 0.99
R5139:Trf UTSW 9 103222934 critical splice donor site probably null
R5692:Trf UTSW 9 103226125 missense possibly damaging 0.87
R6227:Trf UTSW 9 103230305 start gained probably benign
R6365:Trf UTSW 9 103222128 missense possibly damaging 0.70
R6928:Trf UTSW 9 103222108 missense possibly damaging 0.56
R7127:Trf UTSW 9 103225127 missense probably benign
R7231:Trf UTSW 9 103225148 missense probably damaging 1.00
R7648:Trf UTSW 9 103227969 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGCCTTGGAATGATCCTCTTC -3'
(R):5'- ACCCTTCGTAAAGTGGTGCG -3'

Sequencing Primer
(F):5'- GTCTACTTGGACACCTGACAG -3'
(R):5'- AAAGTGGTGCGTTCTCTCC -3'
Posted On2016-07-06