Incidental Mutation 'R5272:Smlr1'
List |< first << previous [record 33 of 45] next >> last >|
ID400425
Institutional Source Beutler Lab
Gene Symbol Smlr1
Ensembl Gene ENSMUSG00000096546
Gene Namesmall leucine-rich protein 1
Synonyms2010003K15Rik
MMRRC Submission 042836-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5272 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location25527943-25536267 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25536027 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 21 (I21V)
Ref Sequence ENSEMBL: ENSMUSP00000136316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179685]
Predicted Effect probably benign
Transcript: ENSMUST00000179685
AA Change: I21V

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000136316
Gene: ENSMUSG00000096546
AA Change: I21V

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191547
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A G 3: 32,718,610 E245G probably damaging Het
Arsb A T 13: 93,794,162 T213S possibly damaging Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Cep152 G A 2: 125,611,030 T374I probably benign Het
Crx C T 7: 15,868,285 C156Y probably damaging Het
Csmd1 T A 8: 16,199,944 T1007S probably damaging Het
Cyp19a1 A T 9: 54,176,614 C164S probably benign Het
Ddx55 A T 5: 124,558,029 I137F possibly damaging Het
Dgkg C A 16: 22,588,294 probably null Het
Dicer1 A G 12: 104,704,240 I1022T probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Dnah5 T C 15: 28,350,665 V2611A probably benign Het
Dnah6 A G 6: 73,127,861 probably null Het
Ercc6 A T 14: 32,519,028 K170* probably null Het
Fibcd1 A T 2: 31,816,623 C399S probably damaging Het
Fibcd1 G T 2: 31,816,624 N398K probably damaging Het
Fnbp4 G A 2: 90,753,115 M327I probably benign Het
Fryl A T 5: 73,065,136 L256* probably null Het
Galr1 T A 18: 82,405,636 Y172F probably benign Het
Gpi1 T C 7: 34,220,690 N186S probably damaging Het
Kcnh8 A G 17: 52,905,015 I614V probably damaging Het
Krt23 A T 11: 99,478,273 I398N probably damaging Het
Mia3 G A 1: 183,328,270 R656* probably null Het
Mup6 G C 4: 60,005,922 G138A probably damaging Het
Nectin3 A G 16: 46,448,476 V521A possibly damaging Het
Nphs1 A G 7: 30,481,642 E1096G possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Panx1 C T 9: 15,044,856 probably null Het
Pcdhb4 A G 18: 37,307,766 Y43C probably benign Het
Plbd1 A G 6: 136,640,158 Y62H probably damaging Het
Rab40b A G 11: 121,357,308 V190A probably damaging Het
Ryr3 T C 2: 112,653,213 E4063G probably damaging Het
Tenm4 T A 7: 96,874,203 Y1614N probably damaging Het
Tesmin C A 19: 3,406,992 A257E probably damaging Het
Tgif1 A G 17: 70,846,254 L34P probably damaging Het
Ticrr C A 7: 79,669,605 T446K probably benign Het
Tmc7 A G 7: 118,561,053 I187T probably benign Het
Tpst2 T A 5: 112,307,952 V119E probably damaging Het
Trf A T 9: 103,227,978 M45K probably damaging Het
Trim45 T C 3: 100,929,919 C524R probably damaging Het
Ttc27 G A 17: 74,742,977 V293I probably damaging Het
Ugt1a6b C T 1: 88,107,227 R96C possibly damaging Het
Vit A G 17: 78,586,835 Q222R probably benign Het
Zfp148 T A 16: 33,496,224 V380D probably damaging Het
Other mutations in Smlr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1528:Smlr1 UTSW 10 25536078 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CGTTCATCAAGAAAGGGCTGG -3'
(R):5'- AGCGCTCCAGTATTCACTCC -3'

Sequencing Primer
(F):5'- TGGGGGAAGAAATCTGTCAATC -3'
(R):5'- GCTCCAGTATTCACTCCACTAATAAG -3'
Posted On2016-07-06