Incidental Mutation 'R5272:Arsb'
List |< first << previous [record 2 of 45] next >> last >|
ID400433
Institutional Source Beutler Lab
Gene Symbol Arsb
Ensembl Gene ENSMUSG00000042082
Gene Namearylsulfatase B
SynonymsAs-1r, As1-s, Ast-1, As-1s, Asr-1, 1110007C02Rik, As1, As1-r, As1-t, As-1, As-1t
MMRRC Submission 042836-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.384) question?
Stock #R5272 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location93771630-93943016 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93794162 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 213 (T213S)
Ref Sequence ENSEMBL: ENSMUSP00000088964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091403]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091403
AA Change: T213S

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088964
Gene: ENSMUSG00000042082
AA Change: T213S

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Sulfatase 46 364 1.7e-78 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220652
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arylsulfatase B encoded by this gene belongs to the sulfatase family. The arylsulfatase B homodimer hydrolyzes sulfate groups of N-Acetyl-D-galactosamine, chondriotin sulfate, and dermatan sulfate. The protein is targeted to the lysozyme. Mucopolysaccharidosis type VI is an autosomal recessive lysosomal storage disorder resulting from a deficiency of arylsulfatase B. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous mutation of this gene results in development of shortened limbs and snout and a broadened head after 4 weeks of age. Mutant animals have elevated concentrations of glucosaminoglycans in the urine and irregular cartilage structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A G 3: 32,718,610 E245G probably damaging Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Cep152 G A 2: 125,611,030 T374I probably benign Het
Crx C T 7: 15,868,285 C156Y probably damaging Het
Csmd1 T A 8: 16,199,944 T1007S probably damaging Het
Cyp19a1 A T 9: 54,176,614 C164S probably benign Het
Ddx55 A T 5: 124,558,029 I137F possibly damaging Het
Dgkg C A 16: 22,588,294 probably null Het
Dicer1 A G 12: 104,704,240 I1022T probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Dnah5 T C 15: 28,350,665 V2611A probably benign Het
Dnah6 A G 6: 73,127,861 probably null Het
Ercc6 A T 14: 32,519,028 K170* probably null Het
Fibcd1 A T 2: 31,816,623 C399S probably damaging Het
Fibcd1 G T 2: 31,816,624 N398K probably damaging Het
Fnbp4 G A 2: 90,753,115 M327I probably benign Het
Fryl A T 5: 73,065,136 L256* probably null Het
Galr1 T A 18: 82,405,636 Y172F probably benign Het
Gpi1 T C 7: 34,220,690 N186S probably damaging Het
Kcnh8 A G 17: 52,905,015 I614V probably damaging Het
Krt23 A T 11: 99,478,273 I398N probably damaging Het
Mia3 G A 1: 183,328,270 R656* probably null Het
Mup6 G C 4: 60,005,922 G138A probably damaging Het
Nectin3 A G 16: 46,448,476 V521A possibly damaging Het
Nphs1 A G 7: 30,481,642 E1096G possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Panx1 C T 9: 15,044,856 probably null Het
Pcdhb4 A G 18: 37,307,766 Y43C probably benign Het
Plbd1 A G 6: 136,640,158 Y62H probably damaging Het
Rab40b A G 11: 121,357,308 V190A probably damaging Het
Ryr3 T C 2: 112,653,213 E4063G probably damaging Het
Smlr1 T C 10: 25,536,027 I21V probably benign Het
Tenm4 T A 7: 96,874,203 Y1614N probably damaging Het
Tesmin C A 19: 3,406,992 A257E probably damaging Het
Tgif1 A G 17: 70,846,254 L34P probably damaging Het
Ticrr C A 7: 79,669,605 T446K probably benign Het
Tmc7 A G 7: 118,561,053 I187T probably benign Het
Tpst2 T A 5: 112,307,952 V119E probably damaging Het
Trf A T 9: 103,227,978 M45K probably damaging Het
Trim45 T C 3: 100,929,919 C524R probably damaging Het
Ttc27 G A 17: 74,742,977 V293I probably damaging Het
Ugt1a6b C T 1: 88,107,227 R96C possibly damaging Het
Vit A G 17: 78,586,835 Q222R probably benign Het
Zfp148 T A 16: 33,496,224 V380D probably damaging Het
Other mutations in Arsb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Arsb APN 13 93790100 missense probably benign 0.07
IGL00334:Arsb APN 13 93939279 missense probably benign 0.01
IGL01560:Arsb APN 13 93807598 missense probably benign 0.01
IGL02408:Arsb APN 13 93794162 missense probably benign 0.19
IGL03396:Arsb APN 13 93939317 missense probably benign 0.01
dipper UTSW 13 93790066 missense possibly damaging 0.95
ouzel UTSW 13 93794220 critical splice donor site probably null
R0145:Arsb UTSW 13 93862287 missense possibly damaging 0.60
R0379:Arsb UTSW 13 93940627 missense probably benign 0.20
R0488:Arsb UTSW 13 93940505 missense probably benign
R0560:Arsb UTSW 13 93790198 missense possibly damaging 0.66
R1938:Arsb UTSW 13 93862150 missense probably damaging 1.00
R1968:Arsb UTSW 13 93807559 missense probably benign 0.00
R2209:Arsb UTSW 13 93862101 missense probably benign 0.14
R2224:Arsb UTSW 13 93794171 missense probably damaging 1.00
R2520:Arsb UTSW 13 93940699 nonsense probably null
R4476:Arsb UTSW 13 93807595 missense probably damaging 1.00
R4910:Arsb UTSW 13 93771977 missense probably benign
R5153:Arsb UTSW 13 93940598 missense probably benign 0.20
R5185:Arsb UTSW 13 93794159 missense probably damaging 1.00
R5475:Arsb UTSW 13 93862265 missense probably benign 0.00
R5580:Arsb UTSW 13 93807545 missense probably damaging 1.00
R6371:Arsb UTSW 13 93790066 missense possibly damaging 0.95
R6668:Arsb UTSW 13 93794220 critical splice donor site probably null
R7084:Arsb UTSW 13 93940616 missense probably benign 0.00
R7735:Arsb UTSW 13 93771983 missense probably benign 0.00
R7801:Arsb UTSW 13 93862327 missense probably damaging 1.00
R7859:Arsb UTSW 13 93862107 missense probably benign 0.03
R7942:Arsb UTSW 13 93862107 missense probably benign 0.03
X0010:Arsb UTSW 13 93794202 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGCTTTCTGCCATGCCGAC -3'
(R):5'- TTCTCCCAGACCTGAGGAAG -3'

Sequencing Primer
(F):5'- TGCCATGCCGACTGTTTC -3'
(R):5'- GACCTGAGGAAGATCCAAATTCTTC -3'
Posted On2016-07-06