Incidental Mutation 'R5272:Olfr284'
ID400441
Institutional Source Beutler Lab
Gene Symbol Olfr284
Ensembl Gene ENSMUSG00000051793
Gene Nameolfactory receptor 284
SynonymsMOR160-4, GA_x6K02T2NBG7-5395976-5396893
MMRRC Submission 042836-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5272 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location98340022-98340987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 98340365 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 208 (A208V)
Ref Sequence ENSEMBL: ENSMUSP00000145864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063289] [ENSMUST00000206647]
Predicted Effect probably benign
Transcript: ENSMUST00000063289
AA Change: A192V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000065626
Gene: ENSMUSG00000051793
AA Change: A192V

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 5.3e-54 PFAM
Pfam:7TM_GPCR_Srsx 33 259 1.3e-5 PFAM
Pfam:7tm_1 39 286 5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206647
AA Change: A208V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A G 3: 32,718,610 E245G probably damaging Het
Arsb A T 13: 93,794,162 T213S possibly damaging Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Cep152 G A 2: 125,611,030 T374I probably benign Het
Crx C T 7: 15,868,285 C156Y probably damaging Het
Csmd1 T A 8: 16,199,944 T1007S probably damaging Het
Cyp19a1 A T 9: 54,176,614 C164S probably benign Het
Ddx55 A T 5: 124,558,029 I137F possibly damaging Het
Dgkg C A 16: 22,588,294 probably null Het
Dicer1 A G 12: 104,704,240 I1022T probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Dnah5 T C 15: 28,350,665 V2611A probably benign Het
Dnah6 A G 6: 73,127,861 probably null Het
Ercc6 A T 14: 32,519,028 K170* probably null Het
Fibcd1 A T 2: 31,816,623 C399S probably damaging Het
Fibcd1 G T 2: 31,816,624 N398K probably damaging Het
Fnbp4 G A 2: 90,753,115 M327I probably benign Het
Fryl A T 5: 73,065,136 L256* probably null Het
Galr1 T A 18: 82,405,636 Y172F probably benign Het
Gpi1 T C 7: 34,220,690 N186S probably damaging Het
Kcnh8 A G 17: 52,905,015 I614V probably damaging Het
Krt23 A T 11: 99,478,273 I398N probably damaging Het
Mia3 G A 1: 183,328,270 R656* probably null Het
Mup6 G C 4: 60,005,922 G138A probably damaging Het
Nectin3 A G 16: 46,448,476 V521A possibly damaging Het
Nphs1 A G 7: 30,481,642 E1096G possibly damaging Het
Panx1 C T 9: 15,044,856 probably null Het
Pcdhb4 A G 18: 37,307,766 Y43C probably benign Het
Plbd1 A G 6: 136,640,158 Y62H probably damaging Het
Rab40b A G 11: 121,357,308 V190A probably damaging Het
Ryr3 T C 2: 112,653,213 E4063G probably damaging Het
Smlr1 T C 10: 25,536,027 I21V probably benign Het
Tenm4 T A 7: 96,874,203 Y1614N probably damaging Het
Tesmin C A 19: 3,406,992 A257E probably damaging Het
Tgif1 A G 17: 70,846,254 L34P probably damaging Het
Ticrr C A 7: 79,669,605 T446K probably benign Het
Tmc7 A G 7: 118,561,053 I187T probably benign Het
Tpst2 T A 5: 112,307,952 V119E probably damaging Het
Trf A T 9: 103,227,978 M45K probably damaging Het
Trim45 T C 3: 100,929,919 C524R probably damaging Het
Ttc27 G A 17: 74,742,977 V293I probably damaging Het
Ugt1a6b C T 1: 88,107,227 R96C possibly damaging Het
Vit A G 17: 78,586,835 Q222R probably benign Het
Zfp148 T A 16: 33,496,224 V380D probably damaging Het
Other mutations in Olfr284
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Olfr284 APN 15 98340173 missense possibly damaging 0.47
IGL02904:Olfr284 APN 15 98340848 missense probably null 0.88
PIT4378001:Olfr284 UTSW 15 98340272 missense possibly damaging 0.95
R0485:Olfr284 UTSW 15 98340929 missense probably benign 0.01
R1435:Olfr284 UTSW 15 98340328 missense possibly damaging 0.69
R4706:Olfr284 UTSW 15 98340778 missense possibly damaging 0.62
R4707:Olfr284 UTSW 15 98340778 missense possibly damaging 0.62
R5314:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5315:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5316:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5317:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5456:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5458:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5548:Olfr284 UTSW 15 98340372 missense probably benign 0.21
R5717:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5921:Olfr284 UTSW 15 98340429 missense probably benign 0.10
R6519:Olfr284 UTSW 15 98340048 missense probably benign 0.00
R6636:Olfr284 UTSW 15 98340950 missense probably benign 0.23
R7112:Olfr284 UTSW 15 98340540 missense possibly damaging 0.81
R7289:Olfr284 UTSW 15 98340062 missense probably damaging 1.00
R7392:Olfr284 UTSW 15 98340311 missense probably benign 0.03
R7403:Olfr284 UTSW 15 98340119 missense probably damaging 1.00
R7633:Olfr284 UTSW 15 98340086 missense probably damaging 1.00
R7724:Olfr284 UTSW 15 98340894 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCGGTAAGAGATAACTGATAAACCC -3'
(R):5'- TTGCTCTACAGCCAGGTGATG -3'

Sequencing Primer
(F):5'- GAGATAACTGATAAACCCCGAGC -3'
(R):5'- CTCTACAGCCAGGTGATGAGTAGC -3'
Posted On2016-07-06