Incidental Mutation 'R5272:Dgkg'
ID400443
Institutional Source Beutler Lab
Gene Symbol Dgkg
Ensembl Gene ENSMUSG00000022861
Gene Namediacylglycerol kinase, gamma
SynonymsE430001K23Rik, 2900055E17Rik, Dagk3
MMRRC Submission 042836-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R5272 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location22468461-22657221 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to A at 22588294 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000087371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023578] [ENSMUST00000089925] [ENSMUST00000137311]
Predicted Effect probably null
Transcript: ENSMUST00000023578
SMART Domains Protein: ENSMUSP00000023578
Gene: ENSMUSG00000022861

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 2 172 9.3e-66 PFAM
EFh 176 204 8.13e-2 SMART
EFh 221 249 1.07e-1 SMART
C1 269 318 1.23e-10 SMART
DAGKc 392 516 5.29e-65 SMART
DAGKa 536 710 1.25e-116 SMART
low complexity region 735 748 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000089925
SMART Domains Protein: ENSMUSP00000087371
Gene: ENSMUSG00000022861

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 5 172 3.9e-54 PFAM
EFh 176 204 8.13e-2 SMART
EFh 221 249 1.07e-1 SMART
C1 269 318 1.23e-10 SMART
C1 334 380 3.35e-3 SMART
DAGKc 431 555 5.29e-65 SMART
DAGKa 575 749 1.25e-116 SMART
low complexity region 774 787 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137311
SMART Domains Protein: ENSMUSP00000114441
Gene: ENSMUSG00000022861

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 2 172 3.8e-67 PFAM
EFh 176 204 8.13e-2 SMART
EFh 221 249 1.07e-1 SMART
C1 269 318 1.23e-10 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that is a member of the type I subfamily of diacylglycerol kinases, which are involved in lipid metabolism. These enzymes generate phosphatidic acid by catalyzing the phosphorylation of diacylglycerol, a fundamental lipid second messenger that activates numerous proteins, including protein kinase C isoforms, Ras guanyl nucleotide-releasing proteins and some transient receptor potential channels. Diacylglycerol kinase gamma has been implicated in cell cycle regulation and in the negative regulation of macrophage differentiation in leukemia cells. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A G 3: 32,718,610 E245G probably damaging Het
Arsb A T 13: 93,794,162 T213S possibly damaging Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Cep152 G A 2: 125,611,030 T374I probably benign Het
Crx C T 7: 15,868,285 C156Y probably damaging Het
Csmd1 T A 8: 16,199,944 T1007S probably damaging Het
Cyp19a1 A T 9: 54,176,614 C164S probably benign Het
Ddx55 A T 5: 124,558,029 I137F possibly damaging Het
Dicer1 A G 12: 104,704,240 I1022T probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Dnah5 T C 15: 28,350,665 V2611A probably benign Het
Dnah6 A G 6: 73,127,861 probably null Het
Ercc6 A T 14: 32,519,028 K170* probably null Het
Fibcd1 A T 2: 31,816,623 C399S probably damaging Het
Fibcd1 G T 2: 31,816,624 N398K probably damaging Het
Fnbp4 G A 2: 90,753,115 M327I probably benign Het
Fryl A T 5: 73,065,136 L256* probably null Het
Galr1 T A 18: 82,405,636 Y172F probably benign Het
Gpi1 T C 7: 34,220,690 N186S probably damaging Het
Kcnh8 A G 17: 52,905,015 I614V probably damaging Het
Krt23 A T 11: 99,478,273 I398N probably damaging Het
Mia3 G A 1: 183,328,270 R656* probably null Het
Mup6 G C 4: 60,005,922 G138A probably damaging Het
Nectin3 A G 16: 46,448,476 V521A possibly damaging Het
Nphs1 A G 7: 30,481,642 E1096G possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Panx1 C T 9: 15,044,856 probably null Het
Pcdhb4 A G 18: 37,307,766 Y43C probably benign Het
Plbd1 A G 6: 136,640,158 Y62H probably damaging Het
Rab40b A G 11: 121,357,308 V190A probably damaging Het
Ryr3 T C 2: 112,653,213 E4063G probably damaging Het
Smlr1 T C 10: 25,536,027 I21V probably benign Het
Tenm4 T A 7: 96,874,203 Y1614N probably damaging Het
Tesmin C A 19: 3,406,992 A257E probably damaging Het
Tgif1 A G 17: 70,846,254 L34P probably damaging Het
Ticrr C A 7: 79,669,605 T446K probably benign Het
Tmc7 A G 7: 118,561,053 I187T probably benign Het
Tpst2 T A 5: 112,307,952 V119E probably damaging Het
Trf A T 9: 103,227,978 M45K probably damaging Het
Trim45 T C 3: 100,929,919 C524R probably damaging Het
Ttc27 G A 17: 74,742,977 V293I probably damaging Het
Ugt1a6b C T 1: 88,107,227 R96C possibly damaging Het
Vit A G 17: 78,586,835 Q222R probably benign Het
Zfp148 T A 16: 33,496,224 V380D probably damaging Het
Other mutations in Dgkg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Dgkg APN 16 22479362 splice site probably benign
IGL01347:Dgkg APN 16 22600590 missense probably benign 0.13
IGL02313:Dgkg APN 16 22570230 splice site probably benign
IGL02498:Dgkg APN 16 22548691 missense probably damaging 1.00
IGL02954:Dgkg APN 16 22622253 missense probably benign 0.00
IGL03103:Dgkg APN 16 22580525 missense probably damaging 1.00
R0014:Dgkg UTSW 16 22565364 splice site probably null
R0636:Dgkg UTSW 16 22579729 splice site probably benign
R0666:Dgkg UTSW 16 22562730 missense probably damaging 1.00
R1056:Dgkg UTSW 16 22600541 missense probably damaging 1.00
R1495:Dgkg UTSW 16 22500379 missense probably damaging 1.00
R1603:Dgkg UTSW 16 22570159 splice site probably benign
R1993:Dgkg UTSW 16 22600594 missense probably damaging 1.00
R2073:Dgkg UTSW 16 22565317 missense probably damaging 0.96
R2192:Dgkg UTSW 16 22588299 missense probably damaging 0.98
R2251:Dgkg UTSW 16 22622260 start codon destroyed probably null 0.98
R2252:Dgkg UTSW 16 22622260 start codon destroyed probably null 0.98
R3104:Dgkg UTSW 16 22575341 missense probably damaging 1.00
R3105:Dgkg UTSW 16 22575341 missense probably damaging 1.00
R3106:Dgkg UTSW 16 22575341 missense probably damaging 1.00
R4804:Dgkg UTSW 16 22575193 intron probably benign
R5364:Dgkg UTSW 16 22600461 missense probably benign 0.03
R5417:Dgkg UTSW 16 22588331 missense possibly damaging 0.50
R5677:Dgkg UTSW 16 22570171 missense probably benign 0.00
R5839:Dgkg UTSW 16 22566494 missense possibly damaging 0.91
R5931:Dgkg UTSW 16 22558038 nonsense probably null
R6313:Dgkg UTSW 16 22519561 missense probably damaging 0.96
R7017:Dgkg UTSW 16 22572713 missense probably benign 0.31
R7135:Dgkg UTSW 16 22500382 missense probably damaging 1.00
R7326:Dgkg UTSW 16 22548690 missense probably damaging 1.00
R7476:Dgkg UTSW 16 22622304 start gained probably benign
R7812:Dgkg UTSW 16 22566415 missense probably damaging 1.00
R8064:Dgkg UTSW 16 22580594 frame shift probably null
Z1088:Dgkg UTSW 16 22469328 missense probably damaging 0.96
Z1088:Dgkg UTSW 16 22572686 missense probably benign 0.31
Z1176:Dgkg UTSW 16 22588398 missense probably benign 0.00
Z1177:Dgkg UTSW 16 22558084 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GGCTAAGGTCTCAGATTTCCGTC -3'
(R):5'- TGGAAGGTCCCTGGATGTTC -3'

Sequencing Primer
(F):5'- AAGGTCTCAGATTTCCGTCTAACTTC -3'
(R):5'- CCCTTTTGTCTTTCAGAATCAAAAAC -3'
Posted On2016-07-06