Incidental Mutation 'R5272:Zfp148'
ID400445
Institutional Source Beutler Lab
Gene Symbol Zfp148
Ensembl Gene ENSMUSG00000022811
Gene Namezinc finger protein 148
SynonymsZBP-89, BFCOL1, BERF-1, beta enolase repressor factor 1, 2210405J08Rik
MMRRC Submission 042836-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5272 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location33380836-33504363 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33496224 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 380 (V380D)
Ref Sequence ENSEMBL: ENSMUSP00000156030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089677] [ENSMUST00000165418] [ENSMUST00000232023]
Predicted Effect probably damaging
Transcript: ENSMUST00000089677
AA Change: V422D

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000087106
Gene: ENSMUSG00000022811
AA Change: V422D

DomainStartEndE-ValueType
low complexity region 141 149 N/A INTRINSIC
ZnF_C2H2 171 193 4.4e-2 SMART
ZnF_C2H2 199 221 2.09e-3 SMART
ZnF_C2H2 227 249 2.24e-3 SMART
ZnF_C2H2 255 278 4.57e0 SMART
low complexity region 314 323 N/A INTRINSIC
low complexity region 328 344 N/A INTRINSIC
low complexity region 589 596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165418
AA Change: V422D

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126338
Gene: ENSMUSG00000022811
AA Change: V422D

DomainStartEndE-ValueType
low complexity region 141 149 N/A INTRINSIC
ZnF_C2H2 171 193 4.4e-2 SMART
ZnF_C2H2 199 221 2.09e-3 SMART
ZnF_C2H2 227 249 2.24e-3 SMART
ZnF_C2H2 255 278 4.57e0 SMART
low complexity region 314 323 N/A INTRINSIC
low complexity region 328 344 N/A INTRINSIC
low complexity region 589 596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000232023
AA Change: V380D

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Kruppel family of zinc finger DNA binding proteins. The encoded protein activates transcription of the T-cell receptor and intestinal alkaline phosphatase genes but represses transcription of the ornithine decarboxylase, vimentin, gastrin, stomelysin, and enolase genes. Increased expression of this gene results in decreased patient survival rates from colorectal cancer, while mutations in this gene have been associated with global developmental delay, hypoplastic corpus callosum, and dysmorphic facies. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption of one allele results in haploinsufficient male infertility in which chimeric males display a loss of germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A G 3: 32,718,610 E245G probably damaging Het
Arsb A T 13: 93,794,162 T213S possibly damaging Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Cep152 G A 2: 125,611,030 T374I probably benign Het
Crx C T 7: 15,868,285 C156Y probably damaging Het
Csmd1 T A 8: 16,199,944 T1007S probably damaging Het
Cyp19a1 A T 9: 54,176,614 C164S probably benign Het
Ddx55 A T 5: 124,558,029 I137F possibly damaging Het
Dgkg C A 16: 22,588,294 probably null Het
Dicer1 A G 12: 104,704,240 I1022T probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Dnah5 T C 15: 28,350,665 V2611A probably benign Het
Dnah6 A G 6: 73,127,861 probably null Het
Ercc6 A T 14: 32,519,028 K170* probably null Het
Fibcd1 A T 2: 31,816,623 C399S probably damaging Het
Fibcd1 G T 2: 31,816,624 N398K probably damaging Het
Fnbp4 G A 2: 90,753,115 M327I probably benign Het
Fryl A T 5: 73,065,136 L256* probably null Het
Galr1 T A 18: 82,405,636 Y172F probably benign Het
Gpi1 T C 7: 34,220,690 N186S probably damaging Het
Kcnh8 A G 17: 52,905,015 I614V probably damaging Het
Krt23 A T 11: 99,478,273 I398N probably damaging Het
Mia3 G A 1: 183,328,270 R656* probably null Het
Mup6 G C 4: 60,005,922 G138A probably damaging Het
Nectin3 A G 16: 46,448,476 V521A possibly damaging Het
Nphs1 A G 7: 30,481,642 E1096G possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Panx1 C T 9: 15,044,856 probably null Het
Pcdhb4 A G 18: 37,307,766 Y43C probably benign Het
Plbd1 A G 6: 136,640,158 Y62H probably damaging Het
Rab40b A G 11: 121,357,308 V190A probably damaging Het
Ryr3 T C 2: 112,653,213 E4063G probably damaging Het
Smlr1 T C 10: 25,536,027 I21V probably benign Het
Tenm4 T A 7: 96,874,203 Y1614N probably damaging Het
Tesmin C A 19: 3,406,992 A257E probably damaging Het
Tgif1 A G 17: 70,846,254 L34P probably damaging Het
Ticrr C A 7: 79,669,605 T446K probably benign Het
Tmc7 A G 7: 118,561,053 I187T probably benign Het
Tpst2 T A 5: 112,307,952 V119E probably damaging Het
Trf A T 9: 103,227,978 M45K probably damaging Het
Trim45 T C 3: 100,929,919 C524R probably damaging Het
Ttc27 G A 17: 74,742,977 V293I probably damaging Het
Ugt1a6b C T 1: 88,107,227 R96C possibly damaging Het
Vit A G 17: 78,586,835 Q222R probably benign Het
Other mutations in Zfp148
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Zfp148 APN 16 33456943 missense probably benign
IGL02059:Zfp148 APN 16 33496563 missense probably damaging 1.00
IGL02389:Zfp148 APN 16 33495446 missense probably damaging 1.00
ANU22:Zfp148 UTSW 16 33456943 missense probably benign
R0680:Zfp148 UTSW 16 33495804 missense possibly damaging 0.74
R1455:Zfp148 UTSW 16 33495465 critical splice donor site probably null
R2175:Zfp148 UTSW 16 33496746 nonsense probably null
R2497:Zfp148 UTSW 16 33496385 missense probably damaging 1.00
R4229:Zfp148 UTSW 16 33434763 missense probably benign 0.00
R4470:Zfp148 UTSW 16 33496232 missense probably damaging 0.98
R4687:Zfp148 UTSW 16 33496819 missense probably damaging 1.00
R4693:Zfp148 UTSW 16 33468135 missense probably damaging 1.00
R4701:Zfp148 UTSW 16 33456908 missense probably benign 0.00
R5479:Zfp148 UTSW 16 33497219 missense probably damaging 0.99
R5511:Zfp148 UTSW 16 33434634 start gained probably benign
R5679:Zfp148 UTSW 16 33495786 missense probably damaging 1.00
R5798:Zfp148 UTSW 16 33496143 missense probably benign 0.03
R6142:Zfp148 UTSW 16 33495459 missense possibly damaging 0.63
R6368:Zfp148 UTSW 16 33497198 missense probably damaging 0.99
R6866:Zfp148 UTSW 16 33468126 missense probably damaging 1.00
R7347:Zfp148 UTSW 16 33434790 missense possibly damaging 0.86
R7419:Zfp148 UTSW 16 33497141 missense possibly damaging 0.87
R7709:Zfp148 UTSW 16 33468175 missense probably damaging 0.99
Z1177:Zfp148 UTSW 16 33496469 missense probably benign 0.10
Z1177:Zfp148 UTSW 16 33496799 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCTACTCGTCGAGCACTAAAG -3'
(R):5'- TTGCAGCTTGAAGATACCGC -3'

Sequencing Primer
(F):5'- TCTACTCGTCGAGCACTAAAGTAAAG -3'
(R):5'- GAAGATACCGCTTCTTCTTCAGAAAC -3'
Posted On2016-07-06